ID: 1162777257

View in Genome Browser
Species Human (GRCh38)
Location 19:12987440-12987462
Sequence CTCACTATCACACTCACTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162777257_1162777262 18 Left 1162777257 19:12987440-12987462 CCCTGAGTGAGTGTGATAGTGAG No data
Right 1162777262 19:12987481-12987503 ACATGTGTGTGGTGTGGTTGTGG No data
1162777257_1162777263 19 Left 1162777257 19:12987440-12987462 CCCTGAGTGAGTGTGATAGTGAG No data
Right 1162777263 19:12987482-12987504 CATGTGTGTGGTGTGGTTGTGGG No data
1162777257_1162777261 12 Left 1162777257 19:12987440-12987462 CCCTGAGTGAGTGTGATAGTGAG No data
Right 1162777261 19:12987475-12987497 GCATTCACATGTGTGTGGTGTGG No data
1162777257_1162777260 7 Left 1162777257 19:12987440-12987462 CCCTGAGTGAGTGTGATAGTGAG No data
Right 1162777260 19:12987470-12987492 TGTCTGCATTCACATGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162777257 Original CRISPR CTCACTATCACACTCACTCA GGG (reversed) Intergenic
No off target data available for this crispr