ID: 1162777261

View in Genome Browser
Species Human (GRCh38)
Location 19:12987475-12987497
Sequence GCATTCACATGTGTGTGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162777256_1162777261 13 Left 1162777256 19:12987439-12987461 CCCCTGAGTGAGTGTGATAGTGA No data
Right 1162777261 19:12987475-12987497 GCATTCACATGTGTGTGGTGTGG No data
1162777258_1162777261 11 Left 1162777258 19:12987441-12987463 CCTGAGTGAGTGTGATAGTGAGA No data
Right 1162777261 19:12987475-12987497 GCATTCACATGTGTGTGGTGTGG No data
1162777257_1162777261 12 Left 1162777257 19:12987440-12987462 CCCTGAGTGAGTGTGATAGTGAG No data
Right 1162777261 19:12987475-12987497 GCATTCACATGTGTGTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162777261 Original CRISPR GCATTCACATGTGTGTGGTG TGG Intergenic
No off target data available for this crispr