ID: 1162779886

View in Genome Browser
Species Human (GRCh38)
Location 19:13001470-13001492
Sequence GTCAACGGGTATTGGTGTAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162779880_1162779886 14 Left 1162779880 19:13001433-13001455 CCGGATGTAGTCTCTGTGTCACG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1162779886 19:13001470-13001492 GTCAACGGGTATTGGTGTACCGG 0: 1
1: 0
2: 0
3: 3
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162779886 Original CRISPR GTCAACGGGTATTGGTGTAC CGG Intronic
902206980 1:14875787-14875809 GGCAACAGGCAGTGGTGTACTGG - Intronic
906205504 1:43984453-43984475 GTCAATGGGTATTGGCATAAAGG + Intronic
910390636 1:86739582-86739604 TTCAAGGGGTTTTGGTGTAAAGG + Intronic
1063047313 10:2405399-2405421 GTCAATGGCAATTGGGGTACTGG + Intergenic
1068064657 10:52114157-52114179 ATCAAAGGGTATTGTTCTACAGG - Intronic
1074794651 10:116930298-116930320 GTCACAGGGGCTTGGTGTACAGG + Intronic
1081275751 11:41147360-41147382 GTCATGGGGTTTTGGTGTACAGG - Intronic
1082716205 11:56617323-56617345 GTCACAGGGTTTTGGTGTACAGG + Intergenic
1098863351 12:75734017-75734039 GTCAAAGGATATTGGTGTTAAGG + Intergenic
1099948569 12:89274023-89274045 GTCCATGGGTAGTGGAGTACTGG + Intergenic
1106701142 13:32230131-32230153 GTCAAGGGGGTTTGTTGTACAGG + Intronic
1109474992 13:62868778-62868800 GTCATGGGGTTTTGTTGTACAGG - Intergenic
1112010689 13:95291390-95291412 GTCAAGAGGTATTGGAGTATTGG - Intronic
1116231327 14:42221419-42221441 GTCACAGGGGTTTGGTGTACAGG - Intergenic
1119244020 14:73087852-73087874 ATCAAAGGGAATTGGTGGACAGG + Intronic
1119585713 14:75832986-75833008 TTCAGCGGGAATTGCTGTACTGG + Intronic
1129560355 15:76559818-76559840 GTCATGGGGATTTGGTGTACAGG - Intronic
1130820588 15:87491117-87491139 GTCACAGGGGTTTGGTGTACTGG + Intergenic
1131823595 15:96297360-96297382 GTCAACAGGCATTACTGTACTGG - Intergenic
1134490685 16:14693686-14693708 GTCACCGGGGTTTGTTGTACAGG + Intronic
1134496066 16:14732804-14732826 GTCACCGGGGTTTGTTGTACAGG + Intronic
1138975980 16:62208508-62208530 GTCATGGGGGATTGTTGTACAGG + Intergenic
1140255919 16:73336302-73336324 GTCACGGGGGTTTGGTGTACAGG + Intergenic
1162779886 19:13001470-13001492 GTCAACGGGTATTGGTGTACCGG + Intronic
1163384359 19:16990283-16990305 GTCAAAGGGTATTGGGGGTCAGG + Intronic
938643424 2:133306753-133306775 GGCAACAGGTTTTGGTGTATTGG + Intronic
939102272 2:137908794-137908816 GTCAATGGTTCTTGGTGTTCAGG - Intergenic
944658405 2:201899605-201899627 GTTAAGGGGGATTGGTGTACAGG - Intergenic
948222545 2:236283853-236283875 GTCAACAGTTTTTGGGGTACAGG - Intergenic
1168741546 20:195860-195882 GTCACAGGGATTTGGTGTACAGG + Intergenic
1171393017 20:24813498-24813520 GTCAGCGGGTGCTGGTGTTCTGG + Intergenic
1182174405 22:28269280-28269302 GTCAAAGGGTATTTGAATACAGG + Intronic
955622978 3:60885850-60885872 GTCAGAGGTTATTGGTGTAAAGG - Intronic
962543216 3:136404433-136404455 TTCATGGGGTATTGGTGTCCTGG - Intronic
962954874 3:140255681-140255703 GTCATGGGGGTTTGGTGTACAGG - Intronic
971267373 4:25107308-25107330 GTCAATGTGTGTTTGTGTACAGG - Intergenic
981646503 4:147004547-147004569 TTCAACTGGTATGGGTGGACAGG + Intergenic
986381032 5:7185918-7185940 GTCATGGGGGTTTGGTGTACAGG - Intergenic
997085849 5:130797560-130797582 GTGAACGTGTATAGGTGTATGGG - Intergenic
1000997892 5:167977254-167977276 GTCATGGGGGTTTGGTGTACAGG - Intronic
1005142434 6:22648797-22648819 GTTAACAGGCATTGGTGTAGTGG - Intergenic
1006324661 6:33344606-33344628 GTCATGGGGCTTTGGTGTACAGG - Intergenic
1006776751 6:36599002-36599024 GTTAAGAGGTATTGGTGTAATGG + Intronic
1012078393 6:94724724-94724746 GTCACAGGGGATTGTTGTACAGG - Intergenic
1012738324 6:102979454-102979476 TTCAAAGGTTATTGGGGTACAGG - Intergenic
1017869852 6:158478179-158478201 GTCACAGGGATTTGGTGTACAGG - Intronic
1017959351 6:159208289-159208311 GGCAACTGGTATTGGTCTTCTGG + Intronic
1028980168 7:96959037-96959059 GTCAAGGGGAATTGCTGTAAAGG + Intergenic
1031602671 7:123730863-123730885 GTCACAGGGGTTTGGTGTACAGG + Intronic
1036430766 8:8688240-8688262 GTCACGGGGGTTTGGTGTACAGG - Intergenic
1037373034 8:18200614-18200636 GTCACAGGGGTTTGGTGTACAGG - Intronic
1038949721 8:32401222-32401244 GTCATGGGGCTTTGGTGTACAGG - Intronic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1043359533 8:79455545-79455567 ATCCACGGATTTTGGTGTACCGG - Intergenic
1048227247 8:132600115-132600137 GTCATCTGTTATTGGTGTATAGG - Intronic
1052694588 9:31859905-31859927 GTCACAGGGGTTTGGTGTACAGG - Intergenic
1053622992 9:39839874-39839896 GTCATGGGGTCTTGTTGTACAGG - Intergenic
1053881881 9:42603353-42603375 GTCATGGGGTCTTGTTGTACAGG + Intergenic
1053890791 9:42690935-42690957 GTCATGGGGTCTTGTTGTACAGG - Intergenic
1054220905 9:62410819-62410841 GTCATGGGGTCTTGTTGTACAGG + Intergenic
1054229809 9:62498353-62498375 GTCATGGGGTCTTGTTGTACAGG - Intergenic
1187696737 X:21929993-21930015 GTCAACAGGGATTGCTGAACGGG + Intergenic
1193296457 X:79838560-79838582 GTCTCCGGCTATTGCTGTACTGG + Intergenic
1199330045 X:146548893-146548915 GTCATGGGGGTTTGGTGTACAGG + Intergenic