ID: 1162786299

View in Genome Browser
Species Human (GRCh38)
Location 19:13037018-13037040
Sequence GACCTCACCCTGTTCAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 218}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162786299_1162786303 0 Left 1162786299 19:13037018-13037040 CCTGGGCTGAACAGGGTGAGGTC 0: 1
1: 0
2: 0
3: 18
4: 218
Right 1162786303 19:13037041-13037063 TCCTGGGCAGAGTCCTTAATGGG 0: 1
1: 0
2: 1
3: 16
4: 140
1162786299_1162786302 -1 Left 1162786299 19:13037018-13037040 CCTGGGCTGAACAGGGTGAGGTC 0: 1
1: 0
2: 0
3: 18
4: 218
Right 1162786302 19:13037040-13037062 CTCCTGGGCAGAGTCCTTAATGG 0: 1
1: 0
2: 1
3: 22
4: 173
1162786299_1162786308 24 Left 1162786299 19:13037018-13037040 CCTGGGCTGAACAGGGTGAGGTC 0: 1
1: 0
2: 0
3: 18
4: 218
Right 1162786308 19:13037065-13037087 GAGACAGGCCATCTGCCCTTGGG 0: 1
1: 0
2: 4
3: 21
4: 153
1162786299_1162786307 23 Left 1162786299 19:13037018-13037040 CCTGGGCTGAACAGGGTGAGGTC 0: 1
1: 0
2: 0
3: 18
4: 218
Right 1162786307 19:13037064-13037086 TGAGACAGGCCATCTGCCCTTGG 0: 1
1: 0
2: 3
3: 12
4: 194
1162786299_1162786305 9 Left 1162786299 19:13037018-13037040 CCTGGGCTGAACAGGGTGAGGTC 0: 1
1: 0
2: 0
3: 18
4: 218
Right 1162786305 19:13037050-13037072 GAGTCCTTAATGGGTGAGACAGG 0: 1
1: 0
2: 0
3: 9
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162786299 Original CRISPR GACCTCACCCTGTTCAGCCC AGG (reversed) Intronic
900408982 1:2504431-2504453 GACCTCTCCCTGCCCAGCCTGGG + Exonic
901142194 1:7042424-7042446 TGCCTCTCCCTGTTCAGCCCTGG + Intronic
901628508 1:10636781-10636803 GAGCACACGCTGTTCAGCTCGGG + Exonic
901750030 1:11400396-11400418 CACCTCTCCCTGTCCAGCACAGG - Intergenic
901811285 1:11768043-11768065 GTCCACACCCTGATCAGCCCTGG + Intronic
902923350 1:19680309-19680331 TGCCTCCCCCTCTTCAGCCCTGG + Intergenic
903070182 1:20723354-20723376 GGCCTCGCCCTGTTCAGGCCAGG + Intronic
903800215 1:25961687-25961709 GGCCTCACAGTGCTCAGCCCGGG + Exonic
904384813 1:30134390-30134412 GACCTCCCCCAGTTCTCCCCAGG - Intergenic
906172798 1:43741905-43741927 GACCTCTGCCTCTTCAGCTCAGG - Intronic
906428659 1:45736147-45736169 GGTCTCACTATGTTCAGCCCAGG + Intronic
907185098 1:52603045-52603067 GACCTCACACGGATCATCCCTGG + Intronic
907243541 1:53093419-53093441 CACCTCACCCCGGCCAGCCCTGG - Intronic
908250853 1:62264546-62264568 GACCTCACTCTGTAGAGCCATGG - Intronic
908768223 1:67572886-67572908 TCCCTCACCCTGCACAGCCCCGG + Intergenic
909693397 1:78436414-78436436 GAGTGCACCCTGGTCAGCCCCGG + Intronic
913333103 1:117683572-117683594 GTCATCACAGTGTTCAGCCCTGG - Intergenic
913957579 1:143319114-143319136 GCCCTGACTCTGCTCAGCCCTGG - Intergenic
914051890 1:144144478-144144500 GCCCTGACTCTGCTCAGCCCTGG - Intergenic
914127307 1:144822063-144822085 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
915203859 1:154254396-154254418 GACCTCACCTTGCTAAGTCCTGG + Intronic
915701909 1:157804284-157804306 GAACTCACCCTGCTCACCCCTGG + Intronic
923247063 1:232142910-232142932 GACTTTACCCTGGTTAGCCCTGG - Intergenic
1062792869 10:320950-320972 GCCCTCATCCTGCTCCGCCCGGG - Intronic
1063667261 10:8070569-8070591 GTCTCCTCCCTGTTCAGCCCCGG - Intronic
1066961526 10:42231299-42231321 GCCCTGACTCTGCTCAGCCCTGG - Intergenic
1069860137 10:71465641-71465663 TACCTGACGCTGTTCAGTCCAGG + Intronic
1070336420 10:75459240-75459262 GATCTTACTATGTTCAGCCCAGG - Intronic
1070461001 10:76670082-76670104 CACCTCACCCTGGCCAGCCAAGG + Intergenic
1072748345 10:97957958-97957980 GACTTTCCCCTGTGCAGCCCTGG - Intronic
1073214130 10:101827270-101827292 GACCTCACCCTTCTCTTCCCAGG - Intronic
1075030993 10:119024827-119024849 GCCCTCACCTTCTTCAGCTCAGG - Intergenic
1075519256 10:123134327-123134349 GGCCTCACCCTCTTCCACCCTGG - Intergenic
1076787261 10:132757493-132757515 GGCCTCCCACTGTACAGCCCAGG + Intronic
1077340062 11:2022240-2022262 GACGCCATCCTGCTCAGCCCTGG - Intergenic
1077635881 11:3841047-3841069 GATCTCCCCCTCTCCAGCCCCGG + Intergenic
1080848846 11:36050324-36050346 GACCTTGTCCTGTTGAGCCCTGG + Intronic
1081595077 11:44453419-44453441 GCCCTCACCATGTTCAGGCCTGG - Intergenic
1081914652 11:46723150-46723172 GACCCCACCCCGGTCAGCCTTGG - Intronic
1083459200 11:62799589-62799611 CACGTCACCCTGTTTGGCCCCGG - Intronic
1083545087 11:63543380-63543402 GACCTCCCCGAGTTCAGGCCAGG + Intronic
1084753310 11:71218593-71218615 GCCCTCACGCTGCTCATCCCTGG - Intronic
1084991104 11:72926131-72926153 GAACCCACCCTCTTCTGCCCAGG - Intronic
1086477218 11:87189724-87189746 GATCTCACTATGTTGAGCCCAGG - Intronic
1091301438 11:134510502-134510524 AATCTCACCATGTTCAGCCTTGG + Intergenic
1202823047 11_KI270721v1_random:77429-77451 GACGCCATCCTGCTCAGCCCTGG - Intergenic
1091427543 12:404288-404310 AGTCTCACTCTGTTCAGCCCAGG - Intronic
1096180171 12:49546388-49546410 GACCTCTCCAAGTCCAGCCCTGG + Intronic
1097250534 12:57630229-57630251 GATCTCACCCTTGTCAGCCCAGG - Exonic
1097680701 12:62646494-62646516 GTCCACTCCCTGTTCTGCCCTGG - Exonic
1101666650 12:106822723-106822745 GTCCCCACCCTGTTCATCACTGG - Intronic
1103519405 12:121527941-121527963 GACATCACCTGGTTCACCCCAGG + Intronic
1103913012 12:124362501-124362523 GAGCTCCCCCTGTTCACCACCGG - Intronic
1104841265 12:131827276-131827298 GGAATCACCCTGTTCAGACCGGG + Intergenic
1109613778 13:64802910-64802932 GATCACACCCTGTGCAGACCTGG - Intergenic
1110748541 13:79085252-79085274 TGCCTCAGCCTGTTCTGCCCTGG - Intergenic
1113424970 13:110200342-110200364 GACTTCACCCTGAGGAGCCCCGG + Intronic
1114511673 14:23267171-23267193 GAGGTCTCCCTGTTCTGCCCTGG + Intronic
1115883178 14:37943593-37943615 TACCTCACCCTCTGCATCCCTGG + Intronic
1118917315 14:70118458-70118480 GAGCTCAGCCTTTTCAGCTCTGG + Intronic
1122427751 14:101621521-101621543 GACCTCTCTCTGTTCTGGCCAGG + Intergenic
1122722474 14:103730111-103730133 GGCCTCAGCCTGTTCAGGGCTGG - Intronic
1202930802 14_KI270725v1_random:30976-30998 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
1123421556 15:20140436-20140458 GCCCTGACTCTGCTCAGCCCTGG - Intergenic
1123443499 15:20306079-20306101 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
1123530782 15:21146976-21146998 GCCCTGACTCTGCTCAGCCCTGG - Intergenic
1124516133 15:30368603-30368625 CACCTCCCCGTGTTCAGCACTGG - Intronic
1124726787 15:32162128-32162150 CACCTCCCCGTGTTCAGCACTGG + Intronic
1129665208 15:77575760-77575782 GCCCACACCCTGTGCTGCCCGGG + Intergenic
1129693646 15:77728355-77728377 GAGCTCACCCTGTTCCGGCCAGG + Intronic
1130241811 15:82200575-82200597 GGCCTCACCTTTTTCAGTCCAGG + Intronic
1131648616 15:94374726-94374748 GCCCTTACCCTGTTCCTCCCAGG + Intronic
1136722716 16:32337807-32337829 GCCCTGACTCTGCTCAGCCCTGG - Intergenic
1136841038 16:33543806-33543828 GCCCTGACTCTGCTCAGCCCTGG - Intergenic
1138366411 16:56481742-56481764 GAACTCATCCTGTTCAGCTTAGG - Intronic
1139488179 16:67271136-67271158 GACCACACCCATCTCAGCCCAGG + Exonic
1141003015 16:80325647-80325669 GAGCTCAGCCTATTCAGGCCTGG - Intergenic
1141137281 16:81474548-81474570 GACCTGACTCAGTTCACCCCTGG - Intronic
1141700262 16:85639117-85639139 TCCCTGACCCTGTTCTGCCCTGG + Intronic
1142404966 16:89883378-89883400 GACCTCTCCCCGTTCACCACAGG - Exonic
1203003715 16_KI270728v1_random:179957-179979 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
1203135323 16_KI270728v1_random:1716364-1716386 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
1203151203 16_KI270728v1_random:1844103-1844125 GCCCTGACTCTGCTCAGCCCTGG - Intergenic
1143451315 17:7038472-7038494 GCCCTCACCCTGATCAACACTGG + Exonic
1144758763 17:17695262-17695284 CACCTCACCCGGTCCAGGCCTGG + Intronic
1145254566 17:21315583-21315605 GAGGTCACCGTGTCCAGCCCAGG - Intergenic
1145322030 17:21772381-21772403 GAGGTCACCGTGTCCAGCCCAGG + Intergenic
1146539152 17:33679865-33679887 TGCCTCTCCCTTTTCAGCCCTGG - Intronic
1146662669 17:34674978-34675000 GATCTCACCCTGCTCACCCTGGG - Intergenic
1147486438 17:40819156-40819178 GACCTCACCCCGTTTAGTTCCGG - Exonic
1147685439 17:42284167-42284189 GACCTCAATCTGTTCTCCCCAGG + Intergenic
1148292579 17:46467842-46467864 GAGCTGACGCTGTTGAGCCCTGG - Intergenic
1148314763 17:46685535-46685557 GAGCTGACGCTGTTGAGCCCTGG - Intronic
1148640452 17:49183663-49183685 GACCCCACCCACTTCTGCCCAGG + Intergenic
1149661091 17:58334215-58334237 CACCTCACCCTGCTCAGGACAGG - Intergenic
1150576401 17:66434463-66434485 GACCTCTCCCTGTTCACCCAAGG - Intronic
1151271940 17:73003557-73003579 GCCCTCTCCGTGTTCAGCCCGGG - Intronic
1151677476 17:75606039-75606061 CACCCCACCCACTTCAGCCCTGG - Intergenic
1154213992 18:12402033-12402055 GCCCTCACCTTCTTCATCCCAGG - Intergenic
1157238693 18:45988812-45988834 GATCTCACCCTTTTCAAGCCAGG + Intronic
1157623058 18:49027107-49027129 GACATCTCTCTGCTCAGCCCTGG + Intergenic
1157712186 18:49857788-49857810 GTCCTCAACCTGCGCAGCCCTGG + Intronic
1158933826 18:62346654-62346676 GACCTCACCCTGGCCAGCAAAGG - Intronic
1159905006 18:74082137-74082159 TACCTCACCCTGGTAAGCCCTGG + Intronic
1160876373 19:1298261-1298283 GAGCTCACCCTGTGCTGCCCTGG + Intronic
1161710186 19:5843401-5843423 GACCTCACCCTGGAGGGCCCTGG - Exonic
1162057825 19:8075297-8075319 GGCTTCACCCTGGTCAGCTCAGG - Exonic
1162549332 19:11349892-11349914 GACCCCACCCCTTACAGCCCTGG + Intronic
1162786299 19:13037018-13037040 GACCTCACCCTGTTCAGCCCAGG - Intronic
1162800951 19:13110147-13110169 GGCCTCAGCCAGGTCAGCCCGGG - Exonic
1163263215 19:16203822-16203844 GACTTGAACCTCTTCAGCCCAGG + Intronic
1163430573 19:17264739-17264761 GACCACTGCCTGTTCAGGCCTGG + Exonic
1163705210 19:18808377-18808399 CACCCCAGCCTGTTCAGCCTGGG - Intergenic
1164849074 19:31465668-31465690 GACAGCTCCCTTTTCAGCCCTGG - Intergenic
1166120091 19:40681142-40681164 GTCCCCACCCTGTTCAGGACTGG - Intronic
1166143491 19:40818767-40818789 GACCTGACCCCGCTCAGCTCAGG - Intronic
1167551297 19:50162865-50162887 GACCTCACCCCCTCCAGGCCTGG + Intronic
1167760087 19:51441041-51441063 GCCCTCACCCTGCCCAGCACTGG + Intergenic
1168689628 19:58368844-58368866 GACCTCACACAGTTGAGTCCGGG + Exonic
1202691288 1_KI270712v1_random:96902-96924 GCCCTGACTCTGCTCAGCCCTGG - Intergenic
924987342 2:284221-284243 GACCACATCCTGCTCAACCCAGG + Intronic
925204408 2:1994238-1994260 GCCCTCACCAGGCTCAGCCCTGG + Intronic
926293549 2:11550655-11550677 GGCCTCACCCAGTTCAGGACTGG + Intronic
926751518 2:16202224-16202246 GACCTCACCCTGATCAGAGCTGG - Intergenic
927216068 2:20668369-20668391 CACCCCACCTTGTTCTGCCCTGG + Intronic
927720706 2:25380051-25380073 CGCCTCTCCCTGTTCACCCCTGG - Intronic
927822590 2:26281439-26281461 AACACCACCCTGTTAAGCCCAGG + Intronic
928109381 2:28494292-28494314 GACCTTGGCCTATTCAGCCCAGG + Intronic
929831716 2:45352283-45352305 CCCCTCACCCTGTCAAGCCCAGG + Intergenic
930018981 2:46989577-46989599 GATCTCTCCCTGTACAGCCCTGG + Intronic
933955102 2:87357048-87357070 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
934174191 2:89564758-89564780 GACCTCAGCCTCATCAGCACAGG - Intergenic
934239291 2:90253262-90253284 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
934273893 2:91563436-91563458 GCCCTGACTCTGCTCAGCCCTGG - Intergenic
934284507 2:91639107-91639129 GACCTCAGCCTCATCAGCACAGG - Intergenic
934461734 2:94216616-94216638 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
935124078 2:100207536-100207558 CAGCTCCCCCTTTTCAGCCCCGG - Intergenic
937863207 2:126729598-126729620 CACCTCATCCTGTTCAGCTCTGG - Intergenic
947640489 2:231705080-231705102 AGTCTCACTCTGTTCAGCCCAGG - Intergenic
1169210267 20:3762408-3762430 GGTCTCACTCTGTCCAGCCCAGG + Intronic
1170767304 20:19301161-19301183 CACCTCTCCCTGTTCAGCTTAGG + Intronic
1174188011 20:48720752-48720774 GACCTCACTCAGTCCATCCCAGG + Intronic
1175396297 20:58665193-58665215 GACCTCACCCTCTACAGAGCAGG - Intronic
1176128849 20:63487856-63487878 GCGCTCACCCTGTGCAGCGCAGG + Intergenic
1176592822 21:8659599-8659621 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
1176686772 21:9855836-9855858 GAACTCACACTGGTCAGCCAGGG + Intergenic
1179570506 21:42275946-42275968 GGCCTGACCCTGTCCAGCTCTGG + Intronic
1179933988 21:44591061-44591083 CACCTCACCCTGTGCCCCCCGGG + Intronic
1179940904 21:44638478-44638500 CACCTCACCCTGTGCCCCCCCGG - Intronic
1180275675 22:10636741-10636763 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
1180550158 22:16531681-16531703 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
1180569936 22:16704916-16704938 AACCGCAGCCTGTTCAGACCAGG + Intergenic
1180945110 22:19688463-19688485 GCCCCCAACCTGCTCAGCCCAGG + Intergenic
1181354518 22:22290140-22290162 GCCCTGACTCTGCTCAGCCCTGG - Intergenic
1181760547 22:25055528-25055550 GGTCTCACTATGTTCAGCCCAGG - Intronic
1181950012 22:26547111-26547133 GGTCTCACTCTGTCCAGCCCAGG + Intronic
1184240010 22:43207033-43207055 GGACTCACCCAGCTCAGCCCTGG - Intronic
1184274272 22:43401261-43401283 GACCTCATCCTGCTCACTCCTGG - Intergenic
1184281764 22:43441449-43441471 GACCATACCCTGGTCAGCACGGG + Intronic
1184695046 22:46134281-46134303 AACCTGCCCCTGTCCAGCCCCGG + Intergenic
950980506 3:17299254-17299276 CACCCCACTCTGTTCTGCCCTGG - Intronic
953031476 3:39182781-39182803 CACTTCTGCCTGTTCAGCCCAGG - Intergenic
954626680 3:52025680-52025702 GTCCTCAACCTGGTCAGTCCAGG - Intergenic
958040274 3:88219190-88219212 GAGCTCCTCCTTTTCAGCCCTGG + Intergenic
961311384 3:126004128-126004150 GACCCCACCCCTTTCTGCCCAGG - Intergenic
962270784 3:133976639-133976661 GACCTCAGTCTCCTCAGCCCTGG + Intronic
962569843 3:136702192-136702214 GATCTCACTATGTTCAGCCCAGG + Intronic
962631141 3:137276954-137276976 GAACTCACCATATTCAGCCTGGG - Intergenic
966256084 3:177917841-177917863 GGACCCACCCTCTTCAGCCCAGG - Intergenic
966759957 3:183408746-183408768 GAACTGAACCTGTCCAGCCCAGG - Intronic
967953865 3:194862139-194862161 GAGCTCACCCAGCTCACCCCAGG + Intergenic
969487142 4:7478621-7478643 GACCTCCCCCTGCTCTGACCTGG + Intronic
969606022 4:8202685-8202707 GGCCTCAGCCGGATCAGCCCCGG - Intronic
969700683 4:8766070-8766092 CTCCTCACCCTCATCAGCCCTGG + Intergenic
969969299 4:11029169-11029191 CAGCTAACCCTGATCAGCCCAGG - Intergenic
975437019 4:74365076-74365098 GACCTCACCCCGTTAGGGCCCGG + Intergenic
975498300 4:75057903-75057925 GGACCCACCCTTTTCAGCCCAGG - Intergenic
978883707 4:113740984-113741006 CACCTAACTCTGTCCAGCCCAGG + Intronic
980117017 4:128688982-128689004 GACTTAACTCTCTTCAGCCCTGG + Intergenic
980350164 4:131673986-131674008 GAACTCACTCTGGTCAGCCAGGG + Intergenic
986916641 5:12627234-12627256 GCCTTCACTCTGTTCAGCGCTGG - Intergenic
987335815 5:16896781-16896803 GACCTCACCCTCTGGAGCACTGG - Intronic
987888878 5:23849957-23849979 TATCTCACACTGTTCATCCCTGG - Intergenic
989151069 5:38300399-38300421 AGTCTCACTCTGTTCAGCCCAGG + Intronic
991062720 5:62395810-62395832 GGTCTCACCATGTTCAGCCCAGG - Intronic
992735151 5:79712146-79712168 CACCTATCCCTGTTCATCCCAGG + Intronic
999910541 5:156193592-156193614 GGCCTCACACTGTTCATCCAGGG - Intronic
1001529514 5:172452537-172452559 GACCTCACTTTGCTGAGCCCTGG + Intronic
1002526741 5:179819492-179819514 TCCCTCACCCTGCTCAGACCGGG + Intronic
1002580514 5:180207522-180207544 GACCTGGCCCTTTTCAGGCCGGG - Intronic
1008344417 6:50409062-50409084 ATCCTCACTCTGTTCTGCCCAGG - Intergenic
1009333939 6:62461372-62461394 GACCACACCCTCTTCAGCAGAGG - Intergenic
1011129358 6:84037782-84037804 GAACTCACGCTGGCCAGCCCGGG + Intronic
1012476050 6:99615027-99615049 GAGCTCACCCTGAACCGCCCAGG + Intronic
1015862865 6:137698824-137698846 GAACTGGTCCTGTTCAGCCCAGG - Intergenic
1016188707 6:141233004-141233026 CACGTCACTGTGTTCAGCCCAGG - Intergenic
1017483522 6:154881623-154881645 AGTCTCACTCTGTTCAGCCCAGG - Intronic
1018243226 6:161798925-161798947 GCCCTCACCCTTTTCATCACAGG + Intronic
1019054406 6:169213185-169213207 AAGCTCAGCCGGTTCAGCCCCGG - Intergenic
1019618064 7:1975476-1975498 GAGCTCACCGTGCCCAGCCCAGG - Intronic
1023018507 7:35988545-35988567 GACCTCACCCTGGGAAGCCCTGG + Intergenic
1026545578 7:71318989-71319011 TACTTCACCCTGGTCAGCCCTGG - Intronic
1026762171 7:73135107-73135129 CACCTCTGCCTGCTCAGCCCTGG + Intergenic
1026867471 7:73832449-73832471 TGCCTCACCCGCTTCAGCCCAGG + Exonic
1026949751 7:74339085-74339107 GTCCCCACCCTGCCCAGCCCAGG - Intronic
1027085053 7:75257578-75257600 CACCTCTGCCTGCTCAGCCCTGG - Intergenic
1028754540 7:94420386-94420408 GACCTCACCACGTTCACCCTAGG - Exonic
1030304006 7:108002007-108002029 GCGCCCACCCTGATCAGCCCCGG + Intronic
1031537340 7:122951554-122951576 CACCTCACCCTGTGCTGCCTTGG + Intergenic
1034535935 7:151725760-151725782 GACCAGCCCCTGTGCAGCCCTGG - Intronic
1036185197 8:6616586-6616608 GTCCTCACCCTCTGCAACCCAGG + Intronic
1038812212 8:30860167-30860189 GGTCTCACTCTGTTCAGTCCAGG + Intronic
1047292231 8:123540962-123540984 GTCTTCACCCAGTTCTGCCCGGG + Exonic
1049371341 8:142269145-142269167 GCCCTGACCCTGGTCAGTCCAGG - Intronic
1049601248 8:143508758-143508780 GACCCCACCCAGCCCAGCCCAGG + Intronic
1053692208 9:40592268-40592290 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
1053782548 9:41625726-41625748 GAACTCACTCTGGTCAGCCAGGG - Intergenic
1054170504 9:61835882-61835904 GAACTCACTCTGGTCAGCCAGGG - Intergenic
1054272592 9:63045217-63045239 GCCCTGACTCTGCTCAGCCCTGG - Intergenic
1054303466 9:63393234-63393256 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
1054402245 9:64719744-64719766 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
1054435848 9:65204059-65204081 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
1054494544 9:65817628-65817650 GCCCTGACTCTGCTCAGCCCTGG - Intergenic
1054667033 9:67744933-67744955 GAACTCACTCTGGTCAGCCAGGG + Intergenic
1057015172 9:91644924-91644946 GGCCTCAGCATGCTCAGCCCAGG + Intronic
1057040657 9:91845226-91845248 GCTCTCACCCTGGGCAGCCCAGG - Intronic
1057443064 9:95095868-95095890 GGTCACACCCTGTCCAGCCCCGG - Intergenic
1060994181 9:127866942-127866964 GACCTCCCCCTGTGTGGCCCTGG - Exonic
1061447979 9:130652253-130652275 GGCCTCAGCCTGGTCAGCCAGGG - Intergenic
1062012154 9:134273050-134273072 GCCCTGAGCCTGCTCAGCCCCGG + Intergenic
1062410592 9:136422206-136422228 GACCCCACCCTCTGCACCCCTGG + Intronic
1203622868 Un_KI270749v1:138405-138427 GCCCTGACTCTGCTCAGCCCTGG + Intergenic
1186057763 X:5668142-5668164 GACCTCACCTTCTGCAACCCTGG - Intergenic
1192765438 X:74134877-74134899 TACCTGACCCTGTTCATCCAAGG + Intergenic
1198123614 X:133620541-133620563 GACCACTCCTTGCTCAGCCCAGG + Intronic
1199009178 X:142739019-142739041 TACTACACCCTGTTCAGGCCTGG + Intergenic
1202016980 Y:20419941-20419963 GACAGCACTGTGTTCAGCCCAGG + Intergenic