ID: 1162787717

View in Genome Browser
Species Human (GRCh38)
Location 19:13046030-13046052
Sequence CTGCTCTGAGAAATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 1, 2: 1, 3: 41, 4: 297}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162787706_1162787717 16 Left 1162787706 19:13045991-13046013 CCACCCTGGCTTCTCCCCAACAC 0: 1
1: 0
2: 2
3: 55
4: 554
Right 1162787717 19:13046030-13046052 CTGCTCTGAGAAATGGAGCTGGG 0: 1
1: 1
2: 1
3: 41
4: 297
1162787708_1162787717 12 Left 1162787708 19:13045995-13046017 CCTGGCTTCTCCCCAACACACAT 0: 1
1: 1
2: 3
3: 29
4: 301
Right 1162787717 19:13046030-13046052 CTGCTCTGAGAAATGGAGCTGGG 0: 1
1: 1
2: 1
3: 41
4: 297
1162787712_1162787717 1 Left 1162787712 19:13046006-13046028 CCCAACACACATCTGGCCTGGTT 0: 1
1: 0
2: 0
3: 16
4: 140
Right 1162787717 19:13046030-13046052 CTGCTCTGAGAAATGGAGCTGGG 0: 1
1: 1
2: 1
3: 41
4: 297
1162787704_1162787717 18 Left 1162787704 19:13045989-13046011 CCCCACCCTGGCTTCTCCCCAAC 0: 1
1: 0
2: 5
3: 50
4: 581
Right 1162787717 19:13046030-13046052 CTGCTCTGAGAAATGGAGCTGGG 0: 1
1: 1
2: 1
3: 41
4: 297
1162787707_1162787717 13 Left 1162787707 19:13045994-13046016 CCCTGGCTTCTCCCCAACACACA 0: 1
1: 0
2: 1
3: 44
4: 449
Right 1162787717 19:13046030-13046052 CTGCTCTGAGAAATGGAGCTGGG 0: 1
1: 1
2: 1
3: 41
4: 297
1162787705_1162787717 17 Left 1162787705 19:13045990-13046012 CCCACCCTGGCTTCTCCCCAACA 0: 1
1: 0
2: 6
3: 41
4: 452
Right 1162787717 19:13046030-13046052 CTGCTCTGAGAAATGGAGCTGGG 0: 1
1: 1
2: 1
3: 41
4: 297
1162787713_1162787717 0 Left 1162787713 19:13046007-13046029 CCAACACACATCTGGCCTGGTTT 0: 1
1: 0
2: 0
3: 12
4: 166
Right 1162787717 19:13046030-13046052 CTGCTCTGAGAAATGGAGCTGGG 0: 1
1: 1
2: 1
3: 41
4: 297
1162787711_1162787717 2 Left 1162787711 19:13046005-13046027 CCCCAACACACATCTGGCCTGGT 0: 1
1: 0
2: 0
3: 12
4: 175
Right 1162787717 19:13046030-13046052 CTGCTCTGAGAAATGGAGCTGGG 0: 1
1: 1
2: 1
3: 41
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162787717 Original CRISPR CTGCTCTGAGAAATGGAGCT GGG Intronic
901080492 1:6581133-6581155 CTGAGCTGGGGAATGGAGCTGGG - Exonic
902758737 1:18566956-18566978 CTGGTCTGTGAACTGGAGCCAGG + Intergenic
902878646 1:19356322-19356344 GTGCTGTGAGAAGTGGTGCTTGG - Intronic
903237160 1:21957415-21957437 CTGTTCTGTGAAGTGGAGGTGGG + Intergenic
904054378 1:27660306-27660328 CTGCTCTAAGAAATGCAGCCAGG + Intergenic
905183470 1:36180089-36180111 CTGCTGGGAGGAATGGAGCTGGG - Intronic
905435214 1:37951110-37951132 GGGCTCTGAGGAATGGGGCTGGG + Intergenic
905685883 1:39907795-39907817 CTGCTTTGAGAAAAGGTACTTGG + Intergenic
907238052 1:53064780-53064802 CTAGTCTAAGAAATGGAGTTGGG - Intronic
907499384 1:54867194-54867216 CTCCTCTGTGAAATGGGGGTAGG + Intronic
907950476 1:59178608-59178630 CTGCTCTGAGCAATGCTGCTAGG - Intergenic
909443455 1:75723361-75723383 CTGCTCTTAGAAAAGGATTTGGG - Intergenic
910194389 1:84625132-84625154 CTGCAGTGAGAAAGGTAGCTCGG - Intergenic
910590309 1:88923022-88923044 CAGAACTGTGAAATGGAGCTTGG + Intergenic
911260254 1:95677538-95677560 CTGCAGTGAGAAATGAAGCATGG + Intergenic
911521380 1:98934193-98934215 CTTTTCTGGGAACTGGAGCTTGG + Intronic
914454464 1:147822965-147822987 TGGATCTGAGAAATGGAGCAGGG - Intergenic
914725573 1:150324425-150324447 CTGCTTTGAGATATGGTTCTTGG + Intronic
915316318 1:155030941-155030963 CTGCCCTGAGAGCAGGAGCTGGG - Intronic
916074005 1:161189837-161189859 ATGCTCAGAGACATGGAGTTAGG + Exonic
917955497 1:180092717-180092739 ATGATCTGAGAACTGGAGATGGG - Exonic
919916499 1:202142887-202142909 TAGGTCTGAGAAATGCAGCTGGG - Intronic
921046957 1:211484702-211484724 CTTCTCTGACACATGGAGGTGGG + Intronic
924893468 1:248309850-248309872 CTGTTCTATGAAATGGTGCTGGG - Intergenic
1063258252 10:4353172-4353194 GTGTTCTGAGATATGGAACTCGG - Intergenic
1063518328 10:6718359-6718381 CTGCACTGAAAAATGGACCCAGG + Intergenic
1065827888 10:29588463-29588485 CTTCTCTGGGAAATGGAGTCTGG + Intronic
1065949974 10:30642839-30642861 CTTCTCTGGGAAATGGAGTCTGG - Intergenic
1067742250 10:48904582-48904604 CGCCTATGAGAAATGGAGCCAGG - Intronic
1069528549 10:69196586-69196608 CTGCTCGGGGATAAGGAGCTTGG + Intronic
1070320333 10:75350152-75350174 CACCTCTGAGGAATGGGGCTGGG + Intergenic
1070731483 10:78831578-78831600 CTGATCTGACAAATGCAGCCTGG + Intergenic
1071083198 10:81837560-81837582 TTGCTCTGAGAAATGGAATGTGG + Intergenic
1071883846 10:89928273-89928295 CTTCTCTGAGTAAAGGAGGTGGG + Intergenic
1075385089 10:122049634-122049656 CTGCTTTGGGAAATACAGCTTGG + Intronic
1076315019 10:129533842-129533864 TGGCTCTGAGAAATGGAGATGGG + Intronic
1077493330 11:2872200-2872222 CTGCTCTGAGACATGCCCCTTGG - Intergenic
1080062262 11:27969651-27969673 ATGGTATGAGAAATGGAGGTAGG - Intergenic
1081401963 11:42653952-42653974 CTGGGCTGAGAAATGGAAGTAGG - Intergenic
1081621708 11:44622638-44622660 GAGCTCTGAGAGATTGAGCTGGG + Intergenic
1081979137 11:47255300-47255322 GTTCTCTGTCAAATGGAGCTCGG + Intronic
1082099722 11:48162428-48162450 CAGCTGTGAGAGATGGAGGTGGG - Intronic
1083572107 11:63766376-63766398 GAGCCCTGAGAAAGGGAGCTGGG + Intronic
1084534742 11:69750128-69750150 CTTCTCTGTGAAATGAAACTTGG - Intergenic
1084571587 11:69962985-69963007 CTGCTCTGAGACACTCAGCTTGG + Intergenic
1084942181 11:72618701-72618723 CTCATCTGAAAAATGGAGGTGGG - Intronic
1085705528 11:78783854-78783876 CTGCTCTGGGAAATGTCACTGGG + Intronic
1088227713 11:107639863-107639885 CAGATCTGAGAAATGGTGGTGGG - Intronic
1090408747 11:126493219-126493241 ATGCAATGAGAATTGGAGCTGGG + Intronic
1090435477 11:126683425-126683447 CAACTCTGAGAAATGGGTCTGGG + Intronic
1090661900 11:128888440-128888462 CAGCTCGGAGAAGAGGAGCTGGG - Intergenic
1091140185 11:133228000-133228022 CTGCCCTGAGAGCTGGGGCTGGG + Intronic
1091839011 12:3605766-3605788 CTGCTCTTAGAAATGCAGTTGGG - Intergenic
1091919131 12:4290228-4290250 CAGCTCAGAGAAATGGCGCAGGG + Intronic
1091957322 12:4657597-4657619 CTGTTGTAATAAATGGAGCTTGG + Intronic
1091979397 12:4853261-4853283 CTGCTCTGAAACATGGAGGAGGG - Intergenic
1092505399 12:9093481-9093503 CTTCCCTGAGACATGGATCTGGG - Exonic
1093566423 12:20610439-20610461 CTGCTGTTAGAAATGTAGATTGG + Intronic
1095337400 12:41045370-41045392 CTGTTCTGAGAAAGGGAGTTGGG + Intronic
1095505032 12:42887228-42887250 CTGATTTGAGAAAAGGAGCCTGG + Intergenic
1097271938 12:57780884-57780906 CTTCTCTGAGAACAGGAGCCAGG - Exonic
1098571707 12:71995290-71995312 GGGCCCTTAGAAATGGAGCTAGG - Intronic
1098786329 12:74761419-74761441 CTCTTCTGACAAATAGAGCTAGG + Intergenic
1099340713 12:81430095-81430117 TTCCTCTGAGAAATGGAGGAAGG - Intronic
1100482477 12:94992649-94992671 GTGCTCTGAGAGAGTGAGCTAGG - Intronic
1101367494 12:104088323-104088345 ATGCTCTGTGTAATGCAGCTAGG - Intronic
1101717061 12:107320361-107320383 CTGCTCCAAAAAATGGTGCTGGG - Intronic
1102801131 12:115735108-115735130 CTGTTCTGAAAAATGTATCTAGG + Intergenic
1103406398 12:120678661-120678683 CAGCTCTAAGAAGTGGAGCTAGG + Intergenic
1104412427 12:128570402-128570424 CTGCTCTGATGAATGGGTCTTGG + Intronic
1104601220 12:130154781-130154803 CTGCTCCGAGACAAGGGGCTGGG + Intergenic
1105045353 12:132998722-132998744 CTGCTTTGAGAAATTTAGGTTGG - Intronic
1105409187 13:20156942-20156964 CTCCACTGGGAGATGGAGCTGGG - Intronic
1106174754 13:27320713-27320735 CTGCTCTGACCAATAGAGCCTGG - Intergenic
1106723527 13:32461021-32461043 CTTCTTTGAAAAATGGTGCTGGG + Intronic
1107183820 13:37494118-37494140 CTGCTCTGTGCCATGGAGCAAGG + Intergenic
1108524328 13:51272943-51272965 CTGCTCTAAGAAATGACACTTGG + Intronic
1110815186 13:79853124-79853146 CTACCCAGAGGAATGGAGCTTGG + Intergenic
1112439058 13:99412363-99412385 CAGCTGAGAGAAATGGAGGTGGG - Intergenic
1113636084 13:111920060-111920082 CGCCTCTGAGCCATGGAGCTGGG + Intergenic
1116998904 14:51352401-51352423 CTACTCTAAGAAATGGGGCCAGG + Intergenic
1117098408 14:52320725-52320747 ATTCTCAGAAAAATGGAGCTTGG - Intronic
1118370581 14:65134328-65134350 CATGGCTGAGAAATGGAGCTGGG + Intergenic
1118887447 14:69879019-69879041 CTCATCTGATAAATGGGGCTAGG + Intronic
1119553925 14:75539165-75539187 CTGCTTAGAGAGAAGGAGCTTGG - Intronic
1121584920 14:95056733-95056755 CTGCTCTGAGAAATGAAAGGTGG - Intergenic
1123682837 15:22775071-22775093 CTTCTCTCTGAAATGCAGCTTGG - Intronic
1124334585 15:28847594-28847616 CTTCTCTCTGAAATGCAGCTTGG - Intergenic
1124791395 15:32730806-32730828 CTGCTCTGAGTCATTGTGCTGGG - Exonic
1126570984 15:50150344-50150366 CCTCCCTGAGAAATGGATCTGGG - Intronic
1127958121 15:63870794-63870816 CAGCACTGAGAACAGGAGCTGGG + Intergenic
1130444966 15:83992168-83992190 CTGCTCTTAGAAATGCAGTGAGG + Intronic
1130844667 15:87733663-87733685 CTGCTCAGAGCAAGGGAACTTGG + Intergenic
1131977324 15:97960180-97960202 ATGCTCTGGGAAACGGAACTCGG - Intergenic
1133256844 16:4522358-4522380 CAGCTCTGAGAAATGTGTCTGGG - Intronic
1133951402 16:10397060-10397082 TTGCTTTGATAAATGGTGCTGGG - Intronic
1134020174 16:10916026-10916048 CTGCTCTCAGCAATTCAGCTGGG + Intronic
1134620037 16:15681293-15681315 CTACTCTGGGCAATGGAGCGAGG - Intronic
1134684127 16:16146886-16146908 CTCACCTGTGAAATGGAGCTAGG + Intergenic
1134893963 16:17867142-17867164 CTTCTTTGAGTACTGGAGCTTGG + Intergenic
1136066240 16:27760876-27760898 CTTCTCTGAGGAAGGGAGCTGGG + Intronic
1136067665 16:27769712-27769734 CTGATATGGGAAATGGACCTCGG + Intronic
1136235443 16:28910948-28910970 CTGCTCTGAGTTCTGGACCTGGG + Exonic
1138477194 16:57278641-57278663 TTGCTCTGTGCAGTGGAGCTGGG + Intronic
1139053982 16:63158604-63158626 CTGCTCATAGAACTGGAGGTTGG + Intergenic
1139193617 16:64893432-64893454 CTAATCTGAGAAATGGAGTAAGG + Intergenic
1139853216 16:69962796-69962818 CTTCCCTGAGAAGTGGAGCAGGG + Intronic
1139882187 16:70185704-70185726 CTTCCCTGAGAAGTGGAGCAGGG + Intronic
1140370322 16:74409800-74409822 CTTCCCTGAGAAGTGGAGCAGGG - Intronic
1140417857 16:74789308-74789330 CTTGTCAGAGAAATGGAACTGGG - Intergenic
1140809722 16:78565844-78565866 CAGTCCTGAGAGATGGAGCTGGG - Intronic
1142499457 17:324090-324112 TTCCTCTGAGAAATGGGGCGGGG - Intronic
1142856103 17:2731288-2731310 CTGGGCTGAGAAATGGGGCTTGG - Intergenic
1144052744 17:11510986-11511008 CTCTTCTGTTAAATGGAGCTAGG + Intronic
1144286879 17:13785507-13785529 GTGGTCTGAGAAGAGGAGCTGGG - Intergenic
1144929577 17:18848529-18848551 CTGTTCTGAGCCCTGGAGCTTGG + Intronic
1146281980 17:31550395-31550417 CGGCTCTGCGAAATGCGGCTGGG - Intergenic
1150328178 17:64273531-64273553 CTGTTCTAAGAAATGTAGCCTGG - Intergenic
1151113789 17:71709825-71709847 CTGCTCTGAAAACTCCAGCTGGG + Intergenic
1151285775 17:73110000-73110022 CTTCACTGAGAAAGGGACCTTGG - Intergenic
1151798165 17:76360696-76360718 AAGCTCTGACAAATAGAGCTGGG - Intronic
1152424669 17:80212455-80212477 CTGCTCAGGGAATGGGAGCTGGG - Intronic
1152517523 17:80834517-80834539 CTGGTCTGAAATGTGGAGCTGGG + Intronic
1153336985 18:3934939-3934961 CAGCACTGAGAAATGGAACAGGG - Intronic
1155684074 18:28525483-28525505 TTTCTCTGAGAAATGGCACTGGG + Intergenic
1156580789 18:38372386-38372408 CTAATCTGTGAAATGGAGCTGGG + Intergenic
1156962723 18:43052288-43052310 CTGCTCTGAGAAATTTAATTAGG + Intronic
1157104087 18:44756814-44756836 CTGCTCTGTGAATTGGAACTTGG + Intronic
1160681984 19:416079-416101 CAGGTCTAAGGAATGGAGCTGGG + Intergenic
1160946886 19:1647855-1647877 CTCTTCTGAGAAATGGACCGAGG + Intronic
1161620544 19:5294713-5294735 CTCCTCTGCAAAATGGAGCATGG + Intronic
1162026623 19:7897895-7897917 TTTGTCTGAGAAAAGGAGCTGGG - Intronic
1162575772 19:11497917-11497939 CAGCTCTGAGCCCTGGAGCTGGG - Intronic
1162787717 19:13046030-13046052 CTGCTCTGAGAAATGGAGCTGGG + Intronic
1162792977 19:13072522-13072544 CTCCTCTGGGAGCTGGAGCTGGG + Intronic
1163129576 19:15264209-15264231 GTGCTCTGAGACCTGGTGCTTGG - Intronic
1163175733 19:15563206-15563228 CTGCACCGAGAAATGGTGCATGG + Intergenic
1165732247 19:38153220-38153242 CAGCTGTGTGACATGGAGCTGGG + Intronic
1165900957 19:39169147-39169169 CTGCTCTGAGAACTGAAGGAGGG + Intronic
1167332600 19:48865707-48865729 CTGCCCTGAGAAATGGGTCAAGG + Intronic
1168351565 19:55679138-55679160 CTGCTGTGAGGAAAGGAACTGGG - Intronic
925513734 2:4656542-4656564 CTGCTTTGTGATATGGAGATGGG - Intergenic
927095275 2:19743624-19743646 CTGCTCTGTAGAATGGAGATGGG - Intergenic
927133520 2:20080317-20080339 CTGCACTGGGAGATGGGGCTGGG - Intergenic
927140400 2:20126361-20126383 CAGCACTCAGAGATGGAGCTGGG - Intergenic
927388716 2:22568232-22568254 CTGATCAGAGCAATGGAGATGGG - Intergenic
927864963 2:26582387-26582409 CTGCTCTAAGAAATAGAATTGGG + Intronic
929889940 2:45910647-45910669 CTGCTGTGAGACACTGAGCTGGG - Intronic
931071802 2:58659975-58659997 GTGCTTTTAGAAGTGGAGCTAGG + Intergenic
931249770 2:60519704-60519726 CTGTTCTGACACATGCAGCTGGG + Intronic
935197107 2:100823582-100823604 TAGCTGTGAGAAATGCAGCTCGG - Intronic
936076793 2:109406399-109406421 CTGCTCTCAGTGATGGACCTGGG - Intronic
937033354 2:118759724-118759746 CTATTCTGAAAAATGGAGCAGGG + Intergenic
937347256 2:121133667-121133689 CTGCCCTGAGGAATGGGGGTGGG + Intergenic
938009831 2:127820147-127820169 ATTCTCTGATAAATGGATCTTGG - Intergenic
939309464 2:140456096-140456118 CTACTCTAAGAAATGGAGAGTGG + Intronic
941258149 2:163259403-163259425 CTGCTCTGAGGGATGGAGGAAGG + Intergenic
941412545 2:165177702-165177724 CTTCCCTGAGAAATTGAGCAGGG - Intronic
942594739 2:177582302-177582324 CTGCACTGAGGTGTGGAGCTAGG + Intergenic
942827093 2:180191918-180191940 CGGCTCTGAGAAATGGAGCTGGG + Intergenic
943172651 2:184423303-184423325 TTTCTCTGAGACATGGAGTTTGG - Intergenic
944376783 2:199054456-199054478 TAGCTCTGATTAATGGAGCTAGG + Intergenic
946144161 2:217716313-217716335 CTGCTGTGACCCATGGAGCTGGG - Intronic
947019876 2:225663325-225663347 CTGCTGTGAAGAATGGATCTGGG - Intergenic
947389865 2:229628019-229628041 CTGCTCTGACCAATAGAGCAGGG + Intronic
947837384 2:233185340-233185362 CTGCTGGGTGAACTGGAGCTTGG - Intronic
1168836241 20:879694-879716 CTGCTCTGAAACCTGGGGCTGGG - Intronic
1169025227 20:2365201-2365223 CAGATCTGAGAAATGGACCAGGG - Intergenic
1169553525 20:6726161-6726183 CAGATTTGAGAATTGGAGCTAGG + Intergenic
1169870578 20:10244069-10244091 CTCCTCTGAGAAATGGGTATTGG + Intronic
1170180692 20:13526670-13526692 CTGATGCAAGAAATGGAGCTAGG + Intronic
1170389388 20:15855177-15855199 TGGCTCTGAAAAATGGAGGTTGG + Intronic
1171271364 20:23820890-23820912 CTGCTCTGCAAAGTGGACCTAGG - Intergenic
1174617017 20:51843479-51843501 CTTCTCTGAGGAAGGGACCTTGG + Intergenic
1176259534 20:64172218-64172240 CTGCTCTGAGCCCTGGAGCTAGG + Intronic
1176282631 20:64322980-64323002 CTGGTCTAAGAAATGGGGCCAGG - Intergenic
1176421151 21:6516878-6516900 CTGCTCTGAGGAATTCAGGTTGG + Intergenic
1176961085 21:15159523-15159545 CTGCTCTGAGATATTTGGCTAGG - Intergenic
1178730477 21:35097756-35097778 CAGCTGTCAGAAGTGGAGCTGGG + Intronic
1179696641 21:43125195-43125217 CTGCTCTGAGGAATTCAGGTTGG + Intergenic
1179832020 21:44002770-44002792 CTCCTCTGCGACATGGAGCTAGG + Intergenic
1180573018 22:16747668-16747690 CTTCTCTGAGAAATGAAGCCAGG - Intergenic
1181466613 22:23113836-23113858 GAGCTCTGGGAAATGGAGATGGG + Intronic
1181661282 22:24351011-24351033 CTGCACTGAGAAATGGCTCAGGG + Intronic
1181939488 22:26464255-26464277 CTGCTCTGGGAATGGGGGCTTGG + Exonic
1182264860 22:29106549-29106571 CTTATCTGAGAAATGGAGGCGGG - Intronic
1182658189 22:31906232-31906254 CTGCCCTGAGAACTTGCGCTTGG - Exonic
1183435461 22:37791826-37791848 TTTCTCTGAGAAATGGATTTGGG - Intergenic
1183483616 22:38077873-38077895 CAGCTCTGAGCAGTGGGGCTGGG + Intergenic
1184040309 22:41939238-41939260 CTGCTCTGGGTAAGGGAGCAGGG - Intronic
1185183602 22:49378845-49378867 CTGCTCTGGGAAAAGCACCTGGG - Intergenic
949490403 3:4583736-4583758 CTGCGCTGGGAACTTGAGCTTGG + Intronic
950483251 3:13257634-13257656 CTGGTCTGAGAAATGGGGTGGGG + Intergenic
950858547 3:16127541-16127563 CAGGCCTGGGAAATGGAGCTTGG - Intergenic
951513341 3:23528871-23528893 CTGCCCTGAGAAAAGGAGTCTGG - Intronic
951708234 3:25565652-25565674 CTGATATGAAAAATGGTGCTTGG - Intronic
953923861 3:46970641-46970663 CTGCTCTGAGACAGGGAGACTGG - Intronic
954391281 3:50269283-50269305 CTGCTCTGGGCAGTGGGGCTGGG + Exonic
954463048 3:50638530-50638552 CTGCTCTGGGTAATGGAGCAGGG + Intronic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
954688212 3:52382088-52382110 CTGCTCTCAGAATCAGAGCTGGG + Intronic
957306921 3:78469192-78469214 CTGCTTTGAGGAATGGAAATTGG + Intergenic
957863384 3:85989631-85989653 CTGCTCTGAGTAAAGAAGTTGGG - Intronic
960702648 3:120451989-120452011 CGGCTCTGAGAAAAGGAGATAGG - Intergenic
960828221 3:121814896-121814918 CTGCTCTCAGAAAATGAGTTAGG - Intronic
962736830 3:138332937-138332959 TTGCTCTGAGGAAGGCAGCTGGG + Intergenic
963023767 3:140898717-140898739 CTGCTCTAAGAATCAGAGCTTGG + Intergenic
964946090 3:162225461-162225483 CTGGTCTGAGAAATGCAGTATGG - Intergenic
965744482 3:171909972-171909994 GTGCTCTGGGAGATGGAGGTGGG - Intronic
966769471 3:183491450-183491472 CTGCTCTGAGATAGGCAGCATGG + Exonic
967015646 3:185479260-185479282 GGGCTCTGGGAAATGAAGCTGGG + Intronic
968008605 3:195259295-195259317 CTGTTCTGAGCAGTGGAGCTAGG - Intronic
968977227 4:3828235-3828257 CTGGGGTGAGAAATGGAGGTTGG + Intergenic
969326837 4:6448943-6448965 CTGCTCTGGGGCATGGAGGTTGG - Intronic
969446132 4:7245678-7245700 CCGCTCTGGGCACTGGAGCTGGG - Intronic
969502794 4:7563588-7563610 GTGCTCCCAGAAAGGGAGCTGGG - Intronic
970473455 4:16399638-16399660 CAGTTCTGAGCAGTGGAGCTGGG - Intergenic
970569137 4:17362556-17362578 CCGCTCTCAGGAAGGGAGCTGGG - Intergenic
970590825 4:17559395-17559417 CTGCTCTGAGAACTGTAGCTTGG + Intergenic
971853803 4:32018015-32018037 CTCTTCAGAAAAATGGAGCTGGG - Intergenic
971983517 4:33788295-33788317 CTGCTCAGAGAAATGAAGTAGGG - Intergenic
972591242 4:40489189-40489211 CTGTCCTGTAAAATGGAGCTTGG + Intronic
972812033 4:42600499-42600521 CAGTTTTGAGAAATGGTGCTTGG - Exonic
976654675 4:87476202-87476224 CTGCTCTGAGCCAGGGACCTAGG + Intronic
976857433 4:89621673-89621695 AAGCTCTGACAAATGAAGCTGGG - Intergenic
978403387 4:108354445-108354467 CTTCCCAGAGAAATGGATCTGGG + Intergenic
978453022 4:108857467-108857489 CTGCTTGGAGAAATGTTGCTTGG - Intronic
984251122 4:177336453-177336475 CTGCACTGAGAAATTGACCTGGG - Intronic
985930950 5:3057592-3057614 CTCCTCTGCTAATTGGAGCTGGG + Intergenic
986139721 5:5018176-5018198 CTGTTCAGAGAAATGGAACAAGG - Intergenic
986393439 5:7305605-7305627 CTTCTCTCTGAAATGCAGCTTGG - Intergenic
987639445 5:20593977-20593999 CTGCACTAAGTAATGCAGCTGGG - Intergenic
989785987 5:45330291-45330313 GTGCTTTAAGAAATTGAGCTTGG + Intronic
991709309 5:69392111-69392133 CTGCTCTAAGAGTTAGAGCTAGG + Intronic
992156888 5:73964222-73964244 CTGCTAGGAGGAATGGAGCTTGG + Intergenic
995261143 5:110105932-110105954 CTGCATTGAGAAATGGACCACGG - Intergenic
996832860 5:127759047-127759069 CTGATCTGATACCTGGAGCTGGG - Intergenic
997180244 5:131820560-131820582 CTGTTCTGAAAAATGGAGGAGGG - Intronic
997612139 5:135222786-135222808 CTCATCTGGAAAATGGAGCTAGG - Intronic
998961750 5:147495190-147495212 CTGGTCTCAGAGAAGGAGCTGGG - Intronic
1001292991 5:170478080-170478102 CTGCACTGAAAGATGGAGGTAGG - Intronic
1001936519 5:175709558-175709580 TTGGTCTGAGAAAGGGACCTGGG - Intergenic
1002037755 5:176485892-176485914 CTTTTCAGAGAGATGGAGCTTGG + Intronic
1002847021 6:955820-955842 CTGGGCTGAGCACTGGAGCTGGG + Intergenic
1002904724 6:1438955-1438977 CTGCTCTGAGGCATGCAGGTGGG - Intergenic
1003243237 6:4362521-4362543 CTCATCTGAGAAATGGAAGTAGG - Intergenic
1003350825 6:5316512-5316534 CTGCCCTGAGAAGTGGAGAGAGG + Intronic
1003431346 6:6041273-6041295 CTGCTCTGACATATTAAGCTGGG - Intergenic
1004274699 6:14225342-14225364 CTCCCCTGAGAAAGGGTGCTAGG - Intergenic
1004472700 6:15943341-15943363 CTGCTATAAGAAGTGGAGCAGGG + Intergenic
1005144148 6:22668301-22668323 GTACTCTGTGAAAGGGAGCTGGG + Intergenic
1005343682 6:24868243-24868265 CTACTCTGTGAAGTGGAGCTGGG - Intronic
1006115796 6:31775583-31775605 CTGCTCTGAGCAATGGAGAGAGG - Intronic
1006249172 6:32766071-32766093 CTGCCCTGAGTAATGGAGCAGGG - Intergenic
1006719225 6:36139276-36139298 GTGCTCTGAGAAAGGCAGCATGG - Exonic
1006931223 6:37689742-37689764 CGGCTCTGAGGTTTGGAGCTGGG - Intronic
1007157421 6:39758759-39758781 CTGCTCAGAAAAATGGCACTGGG + Intergenic
1007420451 6:41716155-41716177 CTCCTCTGTGAGATGGAGATGGG - Intronic
1008174369 6:48249222-48249244 ATACTCTGAGAAACTGAGCTTGG - Intergenic
1008550111 6:52620845-52620867 GTGCTCTGAGAAACAGAGATGGG - Intergenic
1010023102 6:71184172-71184194 CTGCTCTCATAAAAGGAGTTAGG - Intergenic
1012306842 6:97669207-97669229 GTGCTCTGGGAAAGGGAACTGGG - Intergenic
1012485136 6:99712621-99712643 CTGTTCTGAGGAAGGGATCTGGG + Intergenic
1014834278 6:126142799-126142821 ATTTTCTGAGAAATGGAGCTGGG - Intergenic
1016560375 6:145389734-145389756 GTACTCTGAAAAATGGAGGTAGG - Intergenic
1017986218 6:159445280-159445302 CTGCTCTGACCAATGGAGGGTGG + Intergenic
1018963489 6:168465681-168465703 CTGCTCTGAGAGCTGGAACTGGG + Intronic
1018963496 6:168465725-168465747 CTGCTCTGAGAGCTGGAACTGGG + Intronic
1018963504 6:168465770-168465792 CTGCTCTGAGAGCTGGAACTGGG + Intronic
1018963511 6:168465814-168465836 CTGCTCTGAGAGCTGGAACTGGG + Intronic
1018963518 6:168465859-168465881 CTGCTCTGAGAGCTGGAACTGGG + Intronic
1018963526 6:168465904-168465926 CTGCTCTGAGAGCTGGAACTGGG + Intronic
1018963534 6:168465949-168465971 CTGCTCTGAGAGCTGGAACTGGG + Intronic
1018963541 6:168465994-168466016 CTGCTCTGAGAGCTGGAACTGGG + Intronic
1018963548 6:168466039-168466061 CTGCTCTGAGAGCTGGAACTGGG + Intronic
1018963556 6:168466084-168466106 CTGCTCTGAGAGCTGGAACTGGG + Intronic
1018963564 6:168466129-168466151 CTACTCTGAGAGCTGGAACTGGG + Intronic
1018963580 6:168466262-168466284 CTGCTCTGAGAGCTGGAACTGGG + Intronic
1018963587 6:168466303-168466325 CTGCTTTGAAAACTGGAACTGGG + Intronic
1018963594 6:168466348-168466370 CTGCTCTGAGAGCTGGAACTGGG + Intronic
1019108764 6:169692467-169692489 CTGCACTGAGAAAACGAGCATGG - Intronic
1019108766 6:169692499-169692521 CTGCACTGAGAAAACGAGCATGG - Intronic
1019168854 6:170117387-170117409 CTGCGCTGAGCAAGGGGGCTGGG - Intergenic
1019213782 6:170426934-170426956 ATGCTCTGACAAATAGAGCTGGG - Intergenic
1019370272 7:659518-659540 CAGCTGTGAGGAAGGGAGCTGGG + Intronic
1019522349 7:1466607-1466629 TTGCTCTGAGGAAGGGAGCTGGG + Intergenic
1020378930 7:7520658-7520680 CTTTTCTGAGAAATGGTGTTGGG + Intronic
1020564828 7:9781941-9781963 CTGCTCTGAATGATGGAACTCGG + Intergenic
1022530677 7:31065081-31065103 CTGCTCTGGGCAATGATGCTGGG + Intronic
1023301911 7:38782254-38782276 CTGCTCTGAGAACTGGGCCCAGG - Intronic
1024011112 7:45267477-45267499 CAGCTCCGAGAGAAGGAGCTGGG + Intergenic
1024909842 7:54434599-54434621 CTGATTTAAGAAATGGAGATTGG + Intergenic
1025813679 7:64890630-64890652 TTCCTCAGAGAAATAGAGCTTGG - Intronic
1027351401 7:77315383-77315405 CTGCTTTGAGAACTAGAGCCAGG + Intronic
1028676294 7:93466054-93466076 CAGCTCTCAGAAGTGGAGCTGGG + Intronic
1028712958 7:93931552-93931574 CTGCCCTGGGAAAGAGAGCTAGG + Intergenic
1031882047 7:127208943-127208965 CTCCTGTGGGAAATGGAACTGGG - Intronic
1033209544 7:139450753-139450775 CTGCCCTGAGCACTGGAACTGGG + Intergenic
1033583020 7:142753604-142753626 CTGCTCACAGAGATGGAACTAGG - Intronic
1033584569 7:142764526-142764548 CTGCTCACAGAGATGGAACTAGG - Intergenic
1033586047 7:142775081-142775103 CTGCTCACAGAGATGGAACTAGG - Intergenic
1034074134 7:148215489-148215511 AAGCCCTGAGAAATGGAGCTGGG - Intronic
1035049249 7:155989103-155989125 TTGCTCTGGAAAATGGAGATTGG + Intergenic
1036065589 8:5378288-5378310 TTGCTCTGAGATTTCGAGCTTGG + Intergenic
1036942556 8:13065545-13065567 CACCTCTGAGAGAAGGAGCTAGG - Intergenic
1037801627 8:22039092-22039114 CTCATCTGGGAAATGGGGCTGGG - Intergenic
1037904033 8:22704901-22704923 CGGCTCTGAGATTTGGGGCTGGG - Intergenic
1038765352 8:30423038-30423060 CTGCTCGGAGACCTGGAGCCAGG - Intronic
1040532271 8:48275540-48275562 ATGCTGTGAGAACTGGAGTTGGG - Intergenic
1041717011 8:60941604-60941626 CTGATCTGAGAAATGGAGAGAGG + Intergenic
1046508253 8:115164396-115164418 AAGCTCTGAGAAATGGCTCTGGG + Intergenic
1047422653 8:124719942-124719964 TTGCTCAGAGCAATAGAGCTAGG + Intronic
1047940296 8:129822672-129822694 CTGGTCTGACAGAGGGAGCTGGG + Intergenic
1049287077 8:141781658-141781680 CAGGTCACAGAAATGGAGCTGGG - Intergenic
1050923584 9:11235455-11235477 CTGCTCTGTCAGATGGGGCTAGG + Intergenic
1052024643 9:23561064-23561086 CTTCCCTGAGCAATGAAGCTAGG - Intergenic
1052840250 9:33287116-33287138 TTGCTCTGTGAAATGGATTTCGG + Intergenic
1052901789 9:33799742-33799764 CTGCTCACAGAGATGGAACTAGG - Intergenic
1056058724 9:82860249-82860271 TTACTCTGAGAAGTGGAGGTGGG - Intergenic
1056202443 9:84289549-84289571 TTACTCTGAGATATGGACCTGGG + Intronic
1056450666 9:86713748-86713770 CTGATCTTATAATTGGAGCTTGG - Intergenic
1056984156 9:91345937-91345959 TTGGTCTGACAAATGGTGCTGGG + Intronic
1057015247 9:91645315-91645337 CTGCTCAGGGAAATAGAGATGGG + Intronic
1059093824 9:111391056-111391078 CTGCTTTGAGGCATGGAGCCTGG - Intronic
1059352818 9:113677539-113677561 CTGCTCTGAGAAATAGAAAAAGG + Intergenic
1059879452 9:118673994-118674016 CTGCACAGAGACCTGGAGCTAGG + Intergenic
1059918069 9:119126015-119126037 TAGCTGTGAGAAATGGGGCTGGG - Intergenic
1060264488 9:122102491-122102513 CTGCTCTGAGAAAGAGCCCTAGG + Intergenic
1060529536 9:124340153-124340175 CTGAGCTGTTAAATGGAGCTAGG + Intronic
1061138484 9:128750492-128750514 CTGCTGTGGGAAAGGGAGCTGGG + Intronic
1062174346 9:135152764-135152786 CTGCTCTGAGGGGCGGAGCTAGG - Intergenic
1187350155 X:18506271-18506293 GTGCTCTGATAAAAGGAACTAGG - Intronic
1189548763 X:42071664-42071686 CTGCTCTGAAAACAGAAGCTTGG - Intergenic
1190369985 X:49731175-49731197 CTACTCTGTGAATGGGAGCTGGG + Intergenic
1193128100 X:77891241-77891263 CAGCTCTAAGAAACTGAGCTGGG - Intronic
1194806706 X:98338055-98338077 TTTCTGTGAGAAATGAAGCTTGG - Intergenic
1195830540 X:109053812-109053834 CTTCTCTGAGAACTGGAACAAGG - Intergenic
1198411320 X:136372353-136372375 CTGGTGAGAGAAATGGGGCTAGG - Intronic
1198452767 X:136784359-136784381 CTATTCTGTGAAATGGACCTGGG + Intergenic
1201433554 Y:13931258-13931280 CTGCCCTGAGGAATGGAACCAGG + Intergenic
1201460575 Y:14218538-14218560 CTGCTCTCAGAAATGGGTGTGGG - Intergenic