ID: 1162789500

View in Genome Browser
Species Human (GRCh38)
Location 19:13055600-13055622
Sequence CCTCCACTTGGAGCAGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 279}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162789492_1162789500 -3 Left 1162789492 19:13055580-13055602 CCTCCCTCAGCCAAGACCACCCT 0: 1
1: 0
2: 2
3: 63
4: 379
Right 1162789500 19:13055600-13055622 CCTCCACTTGGAGCAGCCTCAGG 0: 1
1: 0
2: 0
3: 30
4: 279
1162789490_1162789500 10 Left 1162789490 19:13055567-13055589 CCTCGGCTCTCCTCCTCCCTCAG 0: 1
1: 1
2: 7
3: 69
4: 818
Right 1162789500 19:13055600-13055622 CCTCCACTTGGAGCAGCCTCAGG 0: 1
1: 0
2: 0
3: 30
4: 279
1162789488_1162789500 21 Left 1162789488 19:13055556-13055578 CCCTCACGGGGCCTCGGCTCTCC 0: 1
1: 0
2: 0
3: 12
4: 185
Right 1162789500 19:13055600-13055622 CCTCCACTTGGAGCAGCCTCAGG 0: 1
1: 0
2: 0
3: 30
4: 279
1162789487_1162789500 22 Left 1162789487 19:13055555-13055577 CCCCTCACGGGGCCTCGGCTCTC 0: 1
1: 0
2: 1
3: 12
4: 154
Right 1162789500 19:13055600-13055622 CCTCCACTTGGAGCAGCCTCAGG 0: 1
1: 0
2: 0
3: 30
4: 279
1162789493_1162789500 -6 Left 1162789493 19:13055583-13055605 CCCTCAGCCAAGACCACCCTCCA 0: 1
1: 0
2: 4
3: 47
4: 337
Right 1162789500 19:13055600-13055622 CCTCCACTTGGAGCAGCCTCAGG 0: 1
1: 0
2: 0
3: 30
4: 279
1162789491_1162789500 0 Left 1162789491 19:13055577-13055599 CCTCCTCCCTCAGCCAAGACCAC 0: 1
1: 0
2: 1
3: 78
4: 612
Right 1162789500 19:13055600-13055622 CCTCCACTTGGAGCAGCCTCAGG 0: 1
1: 0
2: 0
3: 30
4: 279
1162789494_1162789500 -7 Left 1162789494 19:13055584-13055606 CCTCAGCCAAGACCACCCTCCAC 0: 1
1: 0
2: 17
3: 43
4: 404
Right 1162789500 19:13055600-13055622 CCTCCACTTGGAGCAGCCTCAGG 0: 1
1: 0
2: 0
3: 30
4: 279
1162789489_1162789500 20 Left 1162789489 19:13055557-13055579 CCTCACGGGGCCTCGGCTCTCCT 0: 1
1: 0
2: 2
3: 11
4: 182
Right 1162789500 19:13055600-13055622 CCTCCACTTGGAGCAGCCTCAGG 0: 1
1: 0
2: 0
3: 30
4: 279
1162789486_1162789500 25 Left 1162789486 19:13055552-13055574 CCGCCCCTCACGGGGCCTCGGCT 0: 1
1: 0
2: 2
3: 24
4: 228
Right 1162789500 19:13055600-13055622 CCTCCACTTGGAGCAGCCTCAGG 0: 1
1: 0
2: 0
3: 30
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162789500 Original CRISPR CCTCCACTTGGAGCAGCCTC AGG Intronic
900102230 1:966741-966763 TCCCCGCTTCGAGCAGCCTCGGG - Exonic
900505505 1:3028268-3028290 TCTCCACCTGGAGCAGCCATCGG + Intergenic
900589466 1:3453352-3453374 CCTCCACCTGGAGCCGCCTGTGG - Intergenic
900744445 1:4351608-4351630 CCTGCATCTGGAGCAGCCCCAGG + Intergenic
901853048 1:12028304-12028326 CCTCAACTTGAAGCAGCCAGAGG + Intronic
902055409 1:13596535-13596557 CCTCAACTTCAAGCAGCCACTGG - Intronic
902156079 1:14487608-14487630 CCTCCACTTTTAAAAGCCTCTGG - Intergenic
902610899 1:17596627-17596649 CACCCACATGGTGCAGCCTCTGG + Intronic
903817549 1:26075787-26075809 CCTCTGCTTGGAGCACCCTCAGG + Intergenic
905417606 1:37815133-37815155 CCTTCACTTGGAGAAGCTGCTGG + Exonic
905665585 1:39761288-39761310 CCTTCCCTGGGAGCAGCCCCTGG + Intronic
906209285 1:44003154-44003176 CCTCCACCTGCTGCAGCCCCTGG + Intronic
906500923 1:46341414-46341436 CCTCAACCTCGAGCTGCCTCTGG + Intronic
910622669 1:89273604-89273626 CCTGCACTCGGAGCGGCCCCAGG - Intergenic
910706862 1:90139575-90139597 CATGCACTTGGAAAAGCCTCAGG - Intergenic
911009474 1:93263901-93263923 CCTTCACCTGGAAAAGCCTCAGG - Intronic
911063215 1:93765065-93765087 CCTCCCCTAGGAGTAGCCCCCGG - Intronic
915557569 1:156668978-156669000 CCTCCCTTTGGAGAAGCCTCTGG + Exonic
916018593 1:160773440-160773462 CATCTCCTTGGAGCAGCCTTTGG - Intergenic
916074777 1:161193943-161193965 CCTCCACATGGACCAGCTCCAGG - Exonic
917471794 1:175332080-175332102 CCAACACTTGTAGCAGCCTGGGG - Intronic
919923056 1:202177641-202177663 CCTCTCCTGGGAGCACCCTCTGG + Intergenic
920180721 1:204130297-204130319 CCTCCATGGGCAGCAGCCTCGGG - Intergenic
921166949 1:212514517-212514539 TCTCTACCTGCAGCAGCCTCTGG + Intergenic
921804855 1:219442588-219442610 CCTGCATTTCCAGCAGCCTCTGG + Intergenic
922335955 1:224618023-224618045 CCTCCACCTGGCGTAGCCCCGGG - Intronic
922885956 1:229020655-229020677 CCTCCACTTGGGCCACCCACTGG + Intergenic
924451253 1:244181171-244181193 TCTGCACATGGAGCAGCCTGAGG - Intergenic
924570534 1:245234223-245234245 CCTCCACTGGGAACAGGCTACGG - Intronic
1063901976 10:10743048-10743070 CCTCAACTGGGAACAGCCTTAGG - Intergenic
1064562797 10:16609279-16609301 CCTCACCTAGGAGCTGCCTCTGG + Intronic
1070763141 10:79037917-79037939 CCACAACTTCTAGCAGCCTCAGG - Intergenic
1072250373 10:93577520-93577542 CCTGCACTTGAACAAGCCTCAGG - Intronic
1073326155 10:102644857-102644879 CCTGCACGTGGAGAAGCCGCCGG + Exonic
1073550419 10:104395345-104395367 TCTCCATTTGGAGCAGTCTCTGG - Intronic
1075617594 10:123902979-123903001 CCACCACCTGGAGTACCCTCTGG + Intronic
1075675890 10:124295527-124295549 CCAGCAATTGGGGCAGCCTCAGG + Intergenic
1076250502 10:128980547-128980569 CCTGCACCTGCAGCAGGCTCAGG + Intergenic
1076410877 10:130249009-130249031 CCAGCACTTTGATCAGCCTCAGG - Intergenic
1076510758 10:131012259-131012281 TCTCCAGTTGGACCACCCTCTGG - Intergenic
1076524382 10:131102304-131102326 CCTCTCCCTGGAGCAGGCTCAGG - Intronic
1076615043 10:131749584-131749606 CCTCCTCCGGGAGCAGCCACGGG + Intergenic
1077049754 11:561315-561337 CCTGCAGATGGAGCAGACTCCGG - Exonic
1077169233 11:1158997-1159019 CCTCTCCTGGGAGCAGCCCCGGG - Intronic
1077290115 11:1785200-1785222 GCTCCTCTGGGAGCAGCATCTGG - Intergenic
1077293848 11:1814945-1814967 CCTCCCCTTGCAGAAGGCTCTGG + Intergenic
1077909778 11:6563881-6563903 CCTCCACTTGCTGCAGCAGCAGG - Exonic
1077938284 11:6813442-6813464 GCTGCACTTAGAGCAGCATCTGG + Intergenic
1078079335 11:8192702-8192724 CCTGAACTTAGTGCAGCCTCTGG + Intergenic
1079129064 11:17737115-17737137 CCTCCTCAGGGAGCAGCCTCCGG + Intronic
1079449172 11:20584515-20584537 CTTCCACCTGGGGCAGGCTCAGG + Intergenic
1081594788 11:44451798-44451820 CCTCCACGGGGAGCAGGCTCTGG + Intergenic
1082812869 11:57489195-57489217 CATCCCTTTGGAGGAGCCTCGGG + Intronic
1083579320 11:63814347-63814369 CTTCCACTTGCAGGAGCCACAGG + Intronic
1083856214 11:65394276-65394298 CCTCCTCATAGAGCAGCCGCAGG - Exonic
1084820285 11:71684301-71684323 CCCCTACTGTGAGCAGCCTCGGG + Intergenic
1086452060 11:86926789-86926811 CATCTACGTGGGGCAGCCTCTGG + Intronic
1087393305 11:97567062-97567084 CCTCCAGGTGGATCAGGCTCTGG - Intergenic
1088235563 11:107719231-107719253 CATCTACTGGGAGCAGCCTGTGG + Intronic
1088927915 11:114320890-114320912 ACTCCACTTGGAGCAGCTGGGGG - Intergenic
1089293074 11:117450104-117450126 CCTCCACATGGAGCAAGCTGAGG - Intronic
1089705711 11:120276139-120276161 CCACAACCAGGAGCAGCCTCAGG + Intronic
1091262251 11:134244011-134244033 CTTCCACATGGAACAGCCTGTGG - Intronic
1095639278 12:44468214-44468236 CCTGCACCTGGAACAGCCACAGG + Intergenic
1096426357 12:51507094-51507116 TTTCTCCTTGGAGCAGCCTCAGG - Intronic
1099191376 12:79565050-79565072 CCTGCACTCGGAGCGGCCCCAGG + Intergenic
1099285187 12:80708094-80708116 TCTCCACCTTGGGCAGCCTCTGG - Exonic
1099286342 12:80717408-80717430 TCTCCACCTTGGGCAGCCTCTGG - Exonic
1100618629 12:96250473-96250495 CCTCCCCTGGGAGCTGCTTCAGG + Intronic
1102059827 12:109923913-109923935 CCTGCACTCCGAGCAGCCACTGG - Intronic
1103715797 12:122944716-122944738 CCTCCAGCTGGAGCAGGCTGTGG + Intronic
1104919870 12:132285166-132285188 CCTCCTCCTGGAGCTGCCTGAGG - Intronic
1105481720 13:20784432-20784454 GCTCCACTTGGAGAAGGCACTGG - Intronic
1105780435 13:23701396-23701418 CCTCCCCTTGGAAGAGCCTGGGG + Intergenic
1107728867 13:43328132-43328154 CCAGCACTTAGAGCAGCCCCAGG - Intronic
1107869642 13:44734998-44735020 CCTCCACATGGACCATCTTCTGG - Intergenic
1109476122 13:62882318-62882340 CATCCACTTGGAAAAGCCACAGG - Intergenic
1110874384 13:80490841-80490863 CCTGCACTGGGAGCAGCCGGCGG - Intergenic
1111123229 13:83880585-83880607 CCTCCGTTTGGAGCAGACCCTGG + Exonic
1111318034 13:86586442-86586464 CCACCGCTTTGTGCAGCCTCAGG + Intergenic
1113567989 13:111330486-111330508 CCTCCACTTCCAGGAGCCTCTGG + Intronic
1114471817 14:22968341-22968363 CCACCACTTGGAGCTCTCTCAGG - Intronic
1114665356 14:24374339-24374361 CCTCCACCTGGGGCAGCTCCTGG - Exonic
1116713355 14:48397342-48397364 CATCCACTTGGAAAAGCCACAGG + Intergenic
1116893654 14:50294144-50294166 CCTCCTGCTGGATCAGCCTCAGG + Exonic
1117744987 14:58860441-58860463 CTTTCACTGGGAGCAGCCACAGG + Intergenic
1117960922 14:61160592-61160614 CCTCCAATTGCAGCAACCTGTGG - Intergenic
1119645684 14:76346659-76346681 CCTCAACTGGGAGCTGCTTCTGG + Intronic
1119759212 14:77139708-77139730 CCACCACGTTGAGCAGCCGCAGG + Exonic
1120105601 14:80490679-80490701 CCTCCACTTGGGTGAGCCTCAGG + Intronic
1122037654 14:98960468-98960490 CCACCACCTGGAGCAGGCCCAGG + Intergenic
1122793860 14:104195833-104195855 CTTCCACCTGGAGCTGCCTATGG - Intergenic
1122800117 14:104225202-104225224 CCTTCACTCCGAGCAGCCCCGGG - Intergenic
1122800127 14:104225237-104225259 CCTTCACTCAGAGCAGCCCCAGG - Intergenic
1122800135 14:104225272-104225294 CCTTCACTCAGAGCAGCCCCAGG - Intergenic
1122800151 14:104225342-104225364 CCTTCACTCCGAGCAGCCCCGGG - Intergenic
1122800177 14:104225447-104225469 CCTTCACTCCGAGCAGCCCCAGG - Intergenic
1122800185 14:104225482-104225504 CCTTCACTCAGAGCAGCCCCGGG - Intergenic
1122800193 14:104225517-104225539 CCTTCACTCAGAGCAGCCCCGGG - Intergenic
1122800202 14:104225552-104225574 CCTTCACTCAGAGCAGCCCCAGG - Intergenic
1122800218 14:104225622-104225644 CCTTCACTCCGAGCAGCCCCGGG - Intergenic
1122800244 14:104225727-104225749 CCTTCACTCCGAGCAGCCCCAGG - Intergenic
1122800253 14:104225762-104225784 CCTTCACTCCGAGCAGCCCCGGG - Intergenic
1122800270 14:104225832-104225854 CCTTCACTCAGAGCAGCCCCAGG - Intergenic
1122800325 14:104226077-104226099 CCTTCACTCAGAGCAGCCCCAGG - Intergenic
1122800332 14:104226111-104226133 CCTTCACTCAGAGCAGCCCCGGG - Intergenic
1123201985 14:106674887-106674909 CCTCCACCTGCACCTGCCTCCGG + Intergenic
1124198593 15:27656683-27656705 CCTGCACTTGGAGCGGCCAGTGG - Intergenic
1124719377 15:32098332-32098354 CCTGCTTTTGGAGCAGCCTCTGG + Intronic
1126064922 15:44819367-44819389 CCTCCTCTTGCTGCAGTCTCTGG + Intergenic
1126094912 15:45081220-45081242 CCTCCTCTTGCTGCAGTCTCTGG - Intergenic
1127278919 15:57472213-57472235 CCTCTGCTTGGACCAGTCTCTGG - Intronic
1129376845 15:75138899-75138921 CCTGCACCAGGAGCAGCCTCGGG + Intergenic
1129524506 15:76205199-76205221 CCTCCTCTTTGCACAGCCTCTGG + Intronic
1132603873 16:785647-785669 CCTCCTCCTGGAACAGCTTCCGG - Exonic
1132875790 16:2136290-2136312 CCTCCTCCTGCAGCAGCCACAGG + Intergenic
1132950716 16:2560781-2560803 CCTCCACTCGGACTAGCCTGGGG - Intronic
1132963634 16:2639389-2639411 CCTCCACTCGGACTAGCCTGGGG + Intergenic
1134007497 16:10827986-10828008 CCTCCTGTTGGAGCAGCCAGAGG + Intergenic
1134519196 16:14911063-14911085 CCTCCTCCTGCAGCAGCCACAGG - Intronic
1134554730 16:15155163-15155185 CCTCCTCCTGCAGCAGCCACAGG + Intergenic
1134706866 16:16309718-16309740 CCTCCTCCTGCAGCAGCCACAGG - Intergenic
1134960674 16:18402406-18402428 CCTCCTCCTGCAGCAGCCACAGG + Intergenic
1137442498 16:48508788-48508810 CCCGCACTTGGAGCAGCCCTGGG + Intergenic
1138278049 16:55750554-55750576 CCTCCATTTGGATCTGCCTATGG + Intergenic
1138944103 16:61826766-61826788 CCTACACAGGGAGCAGGCTCTGG + Intronic
1140035020 16:71365126-71365148 CCTCCATCTGGAGCACCCTCTGG - Intronic
1140378923 16:74468957-74468979 CCTCCACACGGAGCTGCCTGCGG + Exonic
1142030358 16:87835437-87835459 CCTTCTCTTGGGGCAGCATCTGG + Intronic
1142115885 16:88355888-88355910 CCGCCTCTTGGGTCAGCCTCTGG + Intergenic
1143811036 17:9472126-9472148 CCTCTTAGTGGAGCAGCCTCAGG - Intronic
1144343084 17:14326621-14326643 CCTACTCTTGGGGCAGGCTCAGG + Intronic
1147401719 17:40184304-40184326 CTTCCTCTTGAAGCAGCCCCTGG - Exonic
1148540826 17:48479092-48479114 ACTGCACTTGGACCAGCCTACGG - Intergenic
1149624005 17:58066867-58066889 TCTCCACATGGAGCAGCCCAGGG + Intergenic
1152632485 17:81416819-81416841 CCTCCAAGTGGACCAGCCACAGG - Intronic
1152650675 17:81491189-81491211 AGTCCACTTGGAGCAGACTGAGG - Intergenic
1154144122 18:11852000-11852022 CCTCAACATGGAGCTGCCGCAGG + Exonic
1156251064 18:35352883-35352905 CCTGCACTTGGAAAAGCCACAGG + Intergenic
1156463413 18:37334270-37334292 CCAGCACTGGGGGCAGCCTCTGG - Intronic
1156579871 18:38362605-38362627 CCTCCACTAGCAGCAGCAGCTGG - Intergenic
1156641360 18:39104166-39104188 CCTCCACTTTCAACAGCCTCAGG - Intergenic
1157625131 18:49044806-49044828 ACTCCATGAGGAGCAGCCTCGGG - Intronic
1158599270 18:58843180-58843202 CTTCCACATGGAGCGGGCTCTGG + Intergenic
1159047487 18:63383099-63383121 CAGCCACTTGGAGCAACCCCAGG + Intergenic
1160357898 18:78244269-78244291 CCTACAGTTTTAGCAGCCTCAGG - Intergenic
1161273366 19:3402670-3402692 CCTTCACCTCAAGCAGCCTCTGG - Intronic
1162490279 19:10987442-10987464 CCTCCACTGGGGCCAGCCCCAGG - Intronic
1162789500 19:13055600-13055622 CCTCCACTTGGAGCAGCCTCAGG + Intronic
1162943854 19:14030893-14030915 CCCCCACTTGCAGCAGCTGCTGG - Exonic
1163751416 19:19080442-19080464 CCTTCATTTGGACCAGGCTCAGG + Intronic
1163774162 19:19208247-19208269 CCCCCACTGGCAGCAGCCCCTGG + Intergenic
1165929262 19:39345525-39345547 CCTCCCCTTGAGGCACCCTCAGG + Intronic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1167381030 19:49138199-49138221 TCTCCTCTTGGATCAGCCTGAGG - Exonic
1167551350 19:50163044-50163066 CTTCCAGTTGGAGCAGCTGCAGG - Exonic
1168403998 19:56101343-56101365 CCTGCGCTTGGCGCCGCCTCTGG - Intronic
925284722 2:2708465-2708487 CCTCTTCCTGGAGCAGGCTCTGG + Intergenic
926410723 2:12599430-12599452 CCTCCACTTGGAGTAGGGTGAGG - Intergenic
928033078 2:27797903-27797925 CCTCCTCTCTGAGCAGCCCCTGG - Intronic
928451283 2:31380631-31380653 GCTCCACTGGGAGAAGTCTCTGG + Intronic
928749943 2:34459329-34459351 CATCCACCTGGAAAAGCCTCAGG + Intergenic
930403051 2:50915440-50915462 CCTCCACTTTGAGCAACCCTAGG - Intronic
935145284 2:100391246-100391268 CCTCCACATGGTGGTGCCTCAGG + Intergenic
937100367 2:119263868-119263890 CCTCCACCTGGGGCAGCAGCAGG + Exonic
937982309 2:127622920-127622942 CCTCCAGTGGGGGCAGCCTGAGG - Intronic
939248999 2:139662305-139662327 CCTACACTTGGAAAAGCCTTAGG - Intergenic
940210437 2:151251327-151251349 TCTCCACTTCTAGCAGTCTCAGG + Exonic
942283949 2:174395480-174395502 CTTTCACTTCCAGCAGCCTCTGG + Intronic
946253540 2:218428025-218428047 CCTTGACATGCAGCAGCCTCTGG - Exonic
946491955 2:220157211-220157233 CCTCCTTTTGGAGCATTCTCTGG + Intergenic
946775904 2:223140884-223140906 GCCCCACTTGGACCAGACTCCGG + Intronic
946796401 2:223358863-223358885 CCTCCTCCTTGAGCAGACTCAGG + Intergenic
946805090 2:223463630-223463652 CCTGCACCTGGACAAGCCTCAGG + Intergenic
947875343 2:233464148-233464170 CCTCCGCCTGGAGCAGCAGCTGG + Exonic
948749602 2:240124156-240124178 CCCCCGCTGGGGGCAGCCTCTGG + Intergenic
1169214323 20:3784749-3784771 CCTCCACTTGGAACACGATCTGG - Exonic
1170718329 20:18851582-18851604 CTTTCACTTTAAGCAGCCTCGGG + Intergenic
1171271733 20:23823536-23823558 CCTTCAGGTGCAGCAGCCTCTGG - Intergenic
1171460419 20:25294894-25294916 CCTCCACTTTCAGCTGCCTTTGG + Exonic
1171493346 20:25537695-25537717 CCTCCACCTGCAGCAGCCCAGGG - Intronic
1171986856 20:31666656-31666678 CCTCCAGAGGGAGGAGCCTCTGG - Intronic
1172896339 20:38302924-38302946 CCTCCCTCTGCAGCAGCCTCAGG - Intronic
1173461099 20:43243972-43243994 CCTCCACTTGGAGAGGACCCTGG + Intergenic
1174393311 20:50231488-50231510 CCTCCAGCTGGAGCAACCTCTGG - Intergenic
1176021226 20:62963387-62963409 CCACCCCTTGGAGCAGCGGCAGG + Intronic
1178685867 21:34710208-34710230 CCTTAACTTGCTGCAGCCTCAGG - Intronic
1179983271 21:44907369-44907391 TCTCCTCTTGGGTCAGCCTCGGG - Intronic
1181057674 22:20267778-20267800 CCTCGACTTGGCCCAGCATCGGG + Intronic
1181153989 22:20906096-20906118 GTTCCATTTGGTGCAGCCTCAGG + Intergenic
1182144866 22:27991167-27991189 CCACCACTGGGGGCAGCCTCGGG + Intronic
1182371182 22:29812230-29812252 CCACCATTTGTAGCAGCTTCTGG - Intronic
1183662844 22:39231579-39231601 CCACCACCGGGACCAGCCTCGGG + Intronic
1183716589 22:39536831-39536853 CCTGCACGTGGAGCAGCTCCTGG - Intergenic
1184095826 22:42315754-42315776 CCTCCACCTGGGGCTACCTCTGG - Intronic
1184266423 22:43349342-43349364 CATCCATTTGGAGCCCCCTCAGG + Intergenic
1184715932 22:46281838-46281860 CCTCCACCTGCACCTGCCTCAGG + Intronic
949431976 3:3986679-3986701 CCTTCGCCTGGAGCTGCCTCTGG + Intronic
949533772 3:4979857-4979879 TCTCAACTTGGAGCAGCTCCGGG + Intronic
953688235 3:45094860-45094882 CGTCCCTTTGGACCAGCCTCAGG - Intronic
953799528 3:46011684-46011706 CCTCCTCATGAAGTAGCCTCAGG + Intergenic
954862457 3:53702259-53702281 CCTCCTCTTTGAGGAGGCTCTGG + Intronic
955562969 3:60212886-60212908 GCTCCACTTGGAACATCCTCAGG - Intronic
960126568 3:114005153-114005175 GGTCCACATGGAGCAGCCCCTGG - Intronic
960428847 3:117544156-117544178 CCTCCACTTGGACCACACTTTGG + Intergenic
960479528 3:118171480-118171502 CCCGCACTTGGAGCAGCCGGCGG + Intergenic
961373836 3:126449502-126449524 GCTCCACCTGCAGCAGCCTGGGG - Intronic
961513641 3:127419751-127419773 CCTCACCTTGGGGCTGCCTCAGG - Intergenic
961516344 3:127439812-127439834 CCACCACCTGGACCAGCCTGGGG - Intergenic
962267477 3:133954127-133954149 ACACCACTTTGAGCATCCTCAGG - Intronic
965930064 3:174031218-174031240 CCTTCACTGGGATAAGCCTCTGG - Intronic
966451349 3:180066367-180066389 CCTCCACTTGGGTGAGCCTGTGG + Intergenic
967851813 3:194088183-194088205 CCTCCTCTTGGCCCAGGCTCAGG - Intergenic
968486797 4:866812-866834 CCTCCCCCAGGAGCAGCCTCGGG - Intronic
968548293 4:1209753-1209775 CCTCCCCTTGGTGCCGCCTCCGG - Intergenic
968558809 4:1265468-1265490 CCACCACTGGCAGCAGTCTCTGG - Intergenic
969058241 4:4415363-4415385 CCTGCACTTGGAGGAGCTTGGGG - Intronic
969254481 4:5992890-5992912 CCTGCACCTGGAGCCGCATCAGG - Intergenic
969532251 4:7736546-7736568 CCTCCACTGGGACCCGGCTCAGG - Intronic
969694456 4:8726691-8726713 CCGCCACTTGCAGGAGGCTCAGG + Intergenic
970817904 4:20179302-20179324 CCTGCACTTGGAGCAGCCAGTGG - Intergenic
972786254 4:42329210-42329232 CCTCCATATGGTGCATCCTCTGG - Intergenic
973233282 4:47866970-47866992 GCTCCACTGGGAGCAGACTCTGG + Intronic
974148051 4:57970026-57970048 CCTTCTCTTGGAGCTGCCTGTGG - Intergenic
975477020 4:74834951-74834973 CCTCCAGTTGCAGCACCCTGAGG - Intergenic
980514094 4:133831150-133831172 CCTCCACCTGGAGTAGGCCCCGG - Intergenic
983209071 4:164940137-164940159 CCTCCCCCTGGAGCTGCTTCTGG - Intergenic
984656566 4:182324904-182324926 ATTCCACTGGGAGCATCCTCAGG - Intronic
984926316 4:184810314-184810336 CCTGTATTTGGAACAGCCTCGGG - Intronic
985073561 4:186191499-186191521 CCTCCTCCCGGCGCAGCCTCCGG + Exonic
985348688 4:189035177-189035199 CCTCCACGGGGAGCTGCCTGTGG - Intergenic
985381970 4:189404468-189404490 CCGCAACTGGGTGCAGCCTCAGG + Intergenic
985542342 5:492785-492807 CCTCAAGTGGGAGCAGGCTCTGG - Intronic
985766891 5:1784837-1784859 CCTCTCCGTGGAGCAGCCTCCGG + Intergenic
985930797 5:3056145-3056167 TCTCCTCTGTGAGCAGCCTCTGG - Intergenic
988476536 5:31590972-31590994 CCTCTTCTTGGAGTAGGCTCAGG - Intergenic
990327377 5:54691782-54691804 CTTGCACTTGGAACAGCATCTGG - Intergenic
991869700 5:71097973-71097995 CCTGCACTTGGAAAAGCCACAGG + Intergenic
998572666 5:143277636-143277658 CATACATTTGAAGCAGCCTCAGG + Intergenic
998939083 5:147261100-147261122 CGTCCCCTTGTGGCAGCCTCAGG - Intronic
999094125 5:148963084-148963106 CCTTCACCTGGAGCAGACACTGG - Intronic
1001589071 5:172853252-172853274 CCTCCAGTAGAAGCAGCCACAGG + Intronic
1002397995 5:178972736-178972758 CCCCCACGTGGCTCAGCCTCAGG - Intergenic
1003381851 6:5631663-5631685 CCTCCACTTGGTCCAGCCACTGG - Intronic
1005391318 6:25336401-25336423 CCTCCCCTGTGAGCAGCCTAAGG + Intronic
1005997186 6:30938632-30938654 CCTCCACAGGGAGCCCCCTCAGG + Intergenic
1007263159 6:40577865-40577887 CCACCACTAGGAGCAGCCTTGGG + Intronic
1009857461 6:69283081-69283103 CCTGAGCTTGGAGCAGCCACTGG - Intronic
1010539166 6:77069822-77069844 CTTCCACTTTGTGCAGCCTCAGG - Intergenic
1011640691 6:89413424-89413446 CCTCTACTTAGCCCAGCCTCAGG - Intergenic
1013904382 6:115198286-115198308 CATCCACTTGGAAAAGCCACAGG - Intergenic
1015239916 6:131010790-131010812 CTTCAGCTTGGAGCAACCTCAGG + Intronic
1016858935 6:148698321-148698343 CCCGCACTTGGAGCAGCCGGTGG - Intergenic
1017021288 6:150142677-150142699 CCTCCACCTGGCGCGGCCCCGGG - Intergenic
1017818056 6:158029108-158029130 CCTCCACTTGCACCACCCCCGGG + Intronic
1019455883 7:1127273-1127295 TCGCCACTTGGTGCAGCCTCAGG + Exonic
1021555268 7:21912576-21912598 CACCCACTTGGAGGAGACTCCGG - Intronic
1021716670 7:23468664-23468686 CCTCCGCCTGGAGCCGCGTCCGG - Intronic
1022523208 7:31020938-31020960 GTTCCACCTGGAGCTGCCTCTGG - Intergenic
1022995355 7:35749761-35749783 GCTCTTCTTGGGGCAGCCTCAGG + Intergenic
1023391449 7:39715075-39715097 CCTGCACTTGGAAAAGCCACAGG + Intergenic
1024062655 7:45710431-45710453 TCTCCACCAGGAGCAGCATCAGG + Intronic
1024615759 7:51110264-51110286 CCTCCACCCTGCGCAGCCTCTGG + Intronic
1024934460 7:54698553-54698575 CATCCACCTGGAGCAGCACCTGG - Intergenic
1028493625 7:91441022-91441044 CCTCCACTATGTGCAGCCTCAGG + Intergenic
1028579258 7:92388240-92388262 CCTCCTCTTGATGCAGCCTGTGG + Intronic
1028736272 7:94215981-94216003 CCTCAATTTGTAGCAGCCTGGGG - Intergenic
1029507328 7:100970144-100970166 TCTTGACTTGGAGTAGCCTCAGG + Intronic
1029917835 7:104230731-104230753 TCTCCAGATGGTGCAGCCTCTGG - Intergenic
1031732912 7:125320224-125320246 CCTGCACCTGGAAAAGCCTCAGG + Intergenic
1031885645 7:127243272-127243294 CCTCCAGAAGGTGCAGCCTCAGG - Exonic
1033529904 7:142251351-142251373 AGTCCACTTGTAGCAGCCACAGG + Intergenic
1034472996 7:151265586-151265608 CCTCCCCTTGGAACATCCTCTGG + Intronic
1041519911 8:58744400-58744422 AATCCACTTAGATCAGCCTCAGG - Intergenic
1041555206 8:59146384-59146406 CCAGCACTTGGAGCAGAGTCTGG - Intergenic
1043566849 8:81558500-81558522 CCTTCACGTGGAGCAGGCTCAGG - Intergenic
1048975815 8:139672591-139672613 GCTCCCCTGGGGGCAGCCTCAGG - Intronic
1049197244 8:141322652-141322674 CCCACACCTGGAGCACCCTCAGG + Intergenic
1049298518 8:141856534-141856556 CCTCCAGGTCCAGCAGCCTCTGG - Intergenic
1049335300 8:142081342-142081364 CAGCCACTTGGAGCCACCTCAGG + Intergenic
1049688117 8:143947127-143947149 CCTCCACCTAGAGCACCCTGTGG + Intronic
1050959109 9:11704620-11704642 CCTCTACTTGGAGTAGTCTGGGG - Intergenic
1052027318 9:23588079-23588101 CCTCTGCATGGAGCACCCTCTGG + Intergenic
1053173835 9:35908645-35908667 CCTCCACATGGAGCAGGCTGTGG - Intergenic
1058754815 9:108074410-108074432 ACTCCAATAGGAGCTGCCTCTGG - Intergenic
1058875796 9:109243899-109243921 CCTTCACAGGGAGCCGCCTCTGG - Intronic
1061130595 9:128705798-128705820 GCTCCACATGCAGCTGCCTCCGG - Exonic
1061358493 9:130124509-130124531 CCTCCACTGGGACTAGTCTCAGG - Intronic
1061856762 9:133445730-133445752 CCTCCCCATGGGGCAGCATCAGG + Exonic
1185647037 X:1623276-1623298 TCTCCACTTTCAGCAGCTTCAGG - Exonic
1185826203 X:3253445-3253467 CCTCCAGTTTGAGGAGTCTCTGG - Intergenic
1186610683 X:11135363-11135385 CCTCCAGTTGGAGCTGACACTGG + Intergenic
1187446975 X:19369014-19369036 CCTCCTCTGGGAGCAGGCGCTGG - Intronic
1188156285 X:26747453-26747475 CCTGCATTTGGAGCAGCCATTGG - Intergenic
1189421367 X:40861079-40861101 CCTCAACCTGGAGCAGCCACAGG - Intergenic
1190897250 X:54633125-54633147 CCTCCACTTGTAGCAGGTGCTGG - Intergenic
1190981986 X:55464280-55464302 CCACCAGTGGGAGCAGTCTCAGG + Intergenic
1190986712 X:55508900-55508922 CCACCAGTGGGAGCAGTCTCAGG - Intergenic
1191846628 X:65551839-65551861 CCTCCTCATAGAGCAGCCGCAGG + Intergenic
1193808297 X:86019603-86019625 ACTGCACTTGGACCAGCCTCTGG - Intronic
1194178842 X:90688400-90688422 CCTCCACATGGAGCCACCACTGG - Intergenic
1196547167 X:116975732-116975754 CCACCACTTTCTGCAGCCTCAGG + Intergenic
1198060936 X:133044606-133044628 CCTCCCCGTGGGGCAGGCTCAGG + Intronic
1198218695 X:134580012-134580034 CCGCCAATTGGAGCACCCTTGGG + Intronic
1198378612 X:136063473-136063495 CCTCCACTGGGAGCTGCTTGTGG + Intergenic
1198872320 X:141188777-141188799 CCCGCACTCGGAGCAGCCCCAGG - Intergenic
1199094858 X:143726495-143726517 CCTGCACTTGGATCGGCCCCGGG - Intergenic
1200214564 X:154361919-154361941 CCTCCTCATGCAGCAGCCTAGGG - Intronic
1200525506 Y:4270570-4270592 CCTCCACATGGAGCCACCACTGG - Intergenic
1201252803 Y:12076398-12076420 CCTCCAGTTTGAGGAGTCTCTGG + Intergenic