ID: 1162790090

View in Genome Browser
Species Human (GRCh38)
Location 19:13058203-13058225
Sequence CCTGCTTAGCCCCTGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 6, 3: 20, 4: 280}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162790090_1162790094 -9 Left 1162790090 19:13058203-13058225 CCAGGCTCCAGGGGCTAAGCAGG 0: 1
1: 0
2: 6
3: 20
4: 280
Right 1162790094 19:13058217-13058239 CTAAGCAGGACACCTTTCCAGGG 0: 1
1: 0
2: 0
3: 7
4: 105
1162790090_1162790099 27 Left 1162790090 19:13058203-13058225 CCAGGCTCCAGGGGCTAAGCAGG 0: 1
1: 0
2: 6
3: 20
4: 280
Right 1162790099 19:13058253-13058275 AAAGCCCTCACCTCTCCTGTAGG 0: 1
1: 0
2: 1
3: 15
4: 202
1162790090_1162790093 -10 Left 1162790090 19:13058203-13058225 CCAGGCTCCAGGGGCTAAGCAGG 0: 1
1: 0
2: 6
3: 20
4: 280
Right 1162790093 19:13058216-13058238 GCTAAGCAGGACACCTTTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 97
1162790090_1162790096 4 Left 1162790090 19:13058203-13058225 CCAGGCTCCAGGGGCTAAGCAGG 0: 1
1: 0
2: 6
3: 20
4: 280
Right 1162790096 19:13058230-13058252 CTTTCCAGGGATCTGTCCTCAGG 0: 1
1: 0
2: 1
3: 37
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162790090 Original CRISPR CCTGCTTAGCCCCTGGAGCC TGG (reversed) Intronic
900088814 1:910381-910403 CCTGCCTGGTCCCTGGAGCTGGG + Intergenic
900339013 1:2179028-2179050 ACTGCTTTCCTCCTGGAGCCTGG + Intronic
900565734 1:3331066-3331088 CTCCCTTGGCCCCTGGAGCCCGG - Intronic
900777919 1:4598725-4598747 CTTTCTTGGCCCCTGCAGCCAGG - Intergenic
900929070 1:5724932-5724954 CCTCCTTTGCCCCTGGGGCTGGG + Intergenic
902533019 1:17102664-17102686 CCTGCCTCTCCCCTGCAGCCTGG - Intronic
902820218 1:18938912-18938934 CCTGGTTGGCCCCAGGGGCCGGG + Intronic
902944152 1:19822162-19822184 CCTGCTCTCCCACTGGAGCCTGG - Intergenic
905066962 1:35192449-35192471 CCTGCTTAGGCCCTGGACCCGGG + Exonic
906204449 1:43979490-43979512 CCTGCTGAGCCCCGAGCGCCGGG + Intronic
906691784 1:47797630-47797652 GCTGGCCAGCCCCTGGAGCCTGG - Intronic
907468096 1:54652932-54652954 CCAGGTTAGCCCCTGGACTCAGG - Exonic
907987993 1:59552076-59552098 CCTCCTTAGTCCCTCCAGCCTGG - Intronic
909513106 1:76477375-76477397 CCTGTTTAGGGCCTGGGGCCAGG - Intronic
910693487 1:89988601-89988623 CAAGCTTAAGCCCTGGAGCCAGG + Intergenic
911460403 1:98182014-98182036 CCTGCTTTGCCTCTGAAGACTGG - Intergenic
915584549 1:156837284-156837306 CTTGGTGAGCCCCTGGACCCTGG - Intronic
915772588 1:158444007-158444029 CCAGCTAAGCCCCTTGTGCCAGG - Intergenic
916787496 1:168097047-168097069 GCTGCTTGGCACCGGGAGCCTGG - Exonic
917899752 1:179530456-179530478 CCAGGCTAGGCCCTGGAGCCAGG + Intronic
919847843 1:201652567-201652589 CCAGCTTAGCCCCCAGACCCAGG - Intronic
920511801 1:206557308-206557330 CCTGCAGAGCCCCGGGCGCCCGG - Intronic
922795582 1:228337976-228337998 CCTGCTCAGCCCCTAGGGGCAGG - Exonic
923053239 1:230403624-230403646 GCTGCTTTGCCCCTGGAGCCTGG - Intronic
924722412 1:246636168-246636190 CAAGGTTACCCCCTGGAGCCTGG - Intronic
1062786357 10:268558-268580 CCTGATTAGCCTCTGGACTCAGG - Intergenic
1063476193 10:6330961-6330983 CCTGTTGGACCCCTGGAGCCTGG + Intergenic
1063678141 10:8160276-8160298 CCTGTACAGCCCGTGGAGCCAGG - Intergenic
1064064175 10:12166625-12166647 CTGGCTTACCCGCTGGAGCCAGG + Exonic
1064307181 10:14177828-14177850 GCCATTTAGCCCCTGGAGCCTGG + Intronic
1066064097 10:31750019-31750041 CCTGCCTGGCACCTGGCGCCTGG + Intergenic
1067721670 10:48732087-48732109 CCTACTTGGCCCCTGCACCCTGG + Intronic
1068790754 10:61028812-61028834 TCTGCTTACCCCCTGAATCCTGG + Intergenic
1070667942 10:78358659-78358681 AGTGGTTTGCCCCTGGAGCCAGG + Intergenic
1073459938 10:103660604-103660626 CCTGCCTGGACCCTGGACCCTGG + Intronic
1075977172 10:126706138-126706160 CCTGCTAAACCACTGGAACCAGG - Intergenic
1076378987 10:130012229-130012251 CCTGCCTGGCCCCTGAAGCACGG - Intergenic
1076554335 10:131311904-131311926 CCCGCTGCGCCCCTGGACCCGGG + Intergenic
1077007254 11:363954-363976 CCTGCTCAGTATCTGGAGCCTGG - Intergenic
1077198384 11:1293020-1293042 CCCGCTCAGCCCCTGCAGCGTGG - Intronic
1077216555 11:1397556-1397578 GCTGCTTTGCCCCAGGGGCCTGG + Intronic
1078134559 11:8641039-8641061 CTTGCTGAGCCACTGGAGACTGG + Exonic
1078210249 11:9264862-9264884 CCCGCTTTGTCCCGGGAGCCGGG - Intronic
1078338372 11:10481840-10481862 CCTGCTTTCCTTCTGGAGCCTGG - Intronic
1078348532 11:10573355-10573377 TCTGCTTAGCCCTAGGAGTCTGG - Exonic
1083900193 11:65639875-65639897 CCTGCTTAGGGCCTGGAGATGGG + Intronic
1083960613 11:66012927-66012949 CCTGCTGCGCCCCTGCTGCCAGG - Exonic
1084356256 11:68640801-68640823 CCAACTGAGGCCCTGGAGCCAGG - Intergenic
1086776311 11:90837669-90837691 CCTGCTTACCCCCTGCTGCATGG - Intergenic
1089567174 11:119377944-119377966 CCTGCTTTGCTACTGGGGCCTGG + Intronic
1089642526 11:119857140-119857162 CAAGCTTAGGCCCTGGGGCCTGG - Intergenic
1089649088 11:119900522-119900544 CCTGCTTATCTCCTCCAGCCTGG + Intergenic
1089689471 11:120178286-120178308 CCAGCATAGGCTCTGGAGCCAGG + Intronic
1091931910 12:4403163-4403185 CCCGCTCAGCTCCTGGAGGCAGG + Intergenic
1092070449 12:5627333-5627355 CCTGCTTTGCACCAGGATCCTGG - Intronic
1093661582 12:21763623-21763645 CTAGCTTTGCCCCTGGTGCCAGG + Intergenic
1094376742 12:29798180-29798202 CCTGCCTAGCCCCTGGGAACTGG - Intergenic
1094453014 12:30601818-30601840 CCTGTTTAGCCCCTGGTGAGTGG - Intergenic
1096152997 12:49326116-49326138 CCTTCTTAGCTCCTGGAAACTGG - Exonic
1100270380 12:93018945-93018967 CCTGCTTAGACCTTGGAACCTGG + Intergenic
1100487747 12:95046812-95046834 CCTGCTTAGCTCCTAGAGTCTGG - Intronic
1100619783 12:96259822-96259844 CGTGCTTGGCCCTTGCAGCCTGG - Exonic
1102150771 12:110688147-110688169 CAGGCTTAGCCCCTGGCACCAGG - Exonic
1103204537 12:119118182-119118204 CCTGCTTGGCCCCTGGAGGCAGG + Intronic
1103640341 12:122346408-122346430 TGTGCTTAGCCCTTGGAGCCAGG - Intronic
1104094851 12:125547789-125547811 ACTGCTGGGCACCTGGAGCCAGG - Intronic
1105006035 12:132721149-132721171 CCGGCTTTGCCAATGGAGCCTGG - Exonic
1106224010 13:27771540-27771562 CCAGCTCAGTCCCTGGGGCCAGG + Intergenic
1107437310 13:40391440-40391462 CCAGATAAGCCCCAGGAGCCAGG + Intergenic
1108715782 13:53076642-53076664 CCAGCCTAGCACCTGGAGCAGGG - Intergenic
1113438825 13:110312856-110312878 CGTGCTTTGGCTCTGGAGCCTGG + Intronic
1113788815 13:113016644-113016666 CCTGCCCACCCCCTGGAGGCAGG + Intronic
1114046790 14:18882324-18882346 CCAGCTCAGCCCCAGGATCCAGG + Intergenic
1114117423 14:19637122-19637144 CCAGCTCAGCCCCAGGATCCAGG - Intergenic
1115044720 14:28977456-28977478 CCAGCTAAGAGCCTGGAGCCTGG + Intergenic
1115190935 14:30746405-30746427 TCTCCTCAGCCCCTGGAGTCAGG - Intergenic
1116864352 14:50019297-50019319 CAAGCATAGTCCCTGGAGCCAGG - Intergenic
1118885185 14:69860180-69860202 GCTGCTTCCCCCCTGCAGCCTGG + Intronic
1118905608 14:70021123-70021145 CCTGCTCAGCCCCTCCTGCCAGG - Intronic
1119007552 14:70945136-70945158 CCTGGATAGCCTCAGGAGCCGGG - Intronic
1120900674 14:89573005-89573027 TCTGCTTAGACCCTAGAGCAGGG + Intronic
1121009207 14:90510040-90510062 CCTGGGTTGGCCCTGGAGCCTGG - Intergenic
1121853515 14:97245664-97245686 CCTGCTAAGTCCGTGGAGCCAGG + Intergenic
1122387376 14:101358344-101358366 CATGCTAAGCCCCAGGTGCCCGG + Intergenic
1122995440 14:105261394-105261416 CCTGGTTGGTTCCTGGAGCCGGG - Intronic
1124533886 15:30527588-30527610 AGTGCTTGGCCTCTGGAGCCAGG + Intergenic
1124764762 15:32480021-32480043 AGTGCTTGGCCTCTGGAGCCAGG - Intergenic
1125359428 15:38849961-38849983 CCTGCTTAGTCCATGAAGCCAGG - Intergenic
1126840759 15:52715336-52715358 CCTGCATAGCCTCTGGAAGCAGG + Intergenic
1127959207 15:63878582-63878604 CCTGGGAAGCCCGTGGAGCCAGG + Intergenic
1128133347 15:65245299-65245321 GCTGCCTAGCCCCAGGAGACAGG + Intronic
1128456044 15:67832023-67832045 GCTGCATAGTTCCTGGAGCCAGG + Intronic
1129883930 15:79025703-79025725 CTTGCTTAGCCCCTAGCCCCTGG - Intronic
1129992391 15:79976396-79976418 CTTGCTCAGGCCCTGGAGCCAGG + Intergenic
1130536651 15:84790250-84790272 CCTGCTCAGCACCTCGAGTCAGG - Intronic
1130934185 15:88455009-88455031 GCTGCTTAACCCCAGGAGACTGG + Intergenic
1131378894 15:91947805-91947827 CCTGCTTGGCCCTAGCAGCCAGG + Intronic
1132472552 16:113783-113805 CAGGCTTTGCCCCTGAAGCCTGG - Intronic
1132547622 16:540506-540528 CCTGCTCAGCTCCTGCACCCTGG - Intronic
1132717923 16:1301336-1301358 CCTGCTGGGCTCCCGGAGCCTGG - Intergenic
1132859399 16:2062620-2062642 CTTGCCTGGCACCTGGAGCCTGG + Intronic
1132884719 16:2177614-2177636 CCTGCACAGCCCCTGGAGAGGGG + Exonic
1132993786 16:2812134-2812156 ACTGCTTGGCCCCAGGAGCAAGG + Intergenic
1134597672 16:15509032-15509054 CAAGCTAAGCACCTGGAGCCTGG + Intronic
1137509161 16:49082941-49082963 CCTGCTTAGGCCCTGGAGGCTGG + Intergenic
1138512394 16:57516190-57516212 CATTCTCAGCCCCTGGTGCCTGG - Intronic
1138540734 16:57685820-57685842 CCTGCTGGGCCTCTCGAGCCTGG + Exonic
1139480069 16:67225918-67225940 GCTGCTTAGCCCCAGAAGACAGG - Intronic
1141102930 16:81211191-81211213 CCAGCTCAGCCCCTGCTGCCTGG - Intergenic
1141210385 16:81973880-81973902 CCTGCTTAGCCCCAGGAAGAGGG - Intergenic
1141786997 16:86207703-86207725 GCTGCTTGGCCCCTAGAACCCGG + Intergenic
1142236454 16:88924759-88924781 CCTGCTTGGCCCCCAGTGCCTGG - Intronic
1142744056 17:1946354-1946376 CCCGCTCAGTCCCTGCAGCCAGG + Intronic
1143253217 17:5537726-5537748 CCTCCTTCCCTCCTGGAGCCGGG - Intronic
1143847698 17:9785594-9785616 CCTCCTTAGCCCCTGGTTCCCGG - Intronic
1144301127 17:13923688-13923710 CCTGTTTAGCCCACGGAGCATGG - Intergenic
1145248407 17:21284547-21284569 CCTCCTTAGGCCCAGGATCCGGG - Intergenic
1146282904 17:31557128-31557150 CCTTCTCTGCCCCTGGAGGCAGG + Intergenic
1146501966 17:33372404-33372426 TCTGCCTACCCCCTGGGGCCCGG + Intronic
1147045209 17:37746265-37746287 CCTGCTTCCCCCCTGGTGACGGG + Intergenic
1147969343 17:44211209-44211231 CCTGGTGAGCCCCTGGAGATAGG - Intronic
1148205236 17:45775686-45775708 CCAGCTGAGCCACTGGGGCCTGG + Intergenic
1148357000 17:46982142-46982164 CCTGATCACCCCTTGGAGCCAGG + Intronic
1150706399 17:67491136-67491158 TCGGCTCAGCCTCTGGAGCCCGG + Intronic
1151764334 17:76124430-76124452 CCTGCTTCACCCCTGCAGCCTGG - Intergenic
1151890402 17:76947933-76947955 CCAGCTTGGCTCCTGGGGCCTGG + Exonic
1152095635 17:78270056-78270078 CCCCCTGAGCCCCTGCAGCCTGG - Intergenic
1152224860 17:79088028-79088050 TCTGCTGACCCCCTGCAGCCTGG + Intronic
1152405822 17:80097204-80097226 CATGCTGGGCCCCTGCAGCCCGG - Intronic
1152554491 17:81046115-81046137 CCTCCTTACCCCCTGCAGCTGGG - Intronic
1152941264 17:83173933-83173955 CCTGCACAGGCTCTGGAGCCAGG - Intergenic
1153887079 18:9476091-9476113 CCTGGGTAAGCCCTGGAGCCTGG - Intronic
1156870297 18:41937919-41937941 CAGGCCTAGCCCCAGGAGCCAGG + Intergenic
1157317080 18:46601270-46601292 CCTCCTTAGCCCCCTGAGTCGGG - Intronic
1159011015 18:63058454-63058476 CCTGCTTAGTGCCAGGGGCCTGG + Intergenic
1160556603 18:79729626-79729648 CCTGCTTGGCCCCTGTGTCCTGG + Intronic
1161332952 19:3696940-3696962 CCTCCTTTGCCCCCTGAGCCAGG - Intronic
1162790090 19:13058203-13058225 CCTGCTTAGCCCCTGGAGCCTGG - Intronic
1162918975 19:13889355-13889377 CCTGCTGAGCCCCGGGCTCCTGG + Exonic
1163374105 19:16919912-16919934 CATGCTTATCCCATGGATCCAGG + Intronic
1164693324 19:30226495-30226517 CCTCCTGTGCCCCGGGAGCCTGG + Intergenic
1165129025 19:33621093-33621115 CCTGCTTGTCCCCTGCAGGCTGG + Intergenic
1165444332 19:35848602-35848624 CATGCTCAGACCCAGGAGCCTGG + Intronic
1168519207 19:57035238-57035260 CCTGCATATACCCTGCAGCCTGG - Intergenic
925834556 2:7931446-7931468 CCTGCTTGTCCCCTGCAGCTGGG - Intergenic
926695775 2:15769505-15769527 ACTTCATAGCCCCTGGAGTCTGG - Intergenic
927640713 2:24843867-24843889 CCTGCTGAGCCTCTGGTCCCTGG - Intronic
927667288 2:25041755-25041777 CCGGCTTAGCCCACGCAGCCTGG + Intergenic
927859463 2:26551389-26551411 CCTAGTTGGCCCCTAGAGCCCGG - Intronic
929440357 2:41961311-41961333 CCTGCTTACAGACTGGAGCCAGG + Intergenic
931516666 2:63054210-63054232 CCTACCCAGACCCTGGAGCCCGG - Intronic
932229856 2:70074184-70074206 CCTGCTTAGCTCCTTGAGTTTGG - Intergenic
933287750 2:80402463-80402485 CCTGGATAGCCCCAGGATCCAGG - Intronic
934553576 2:95276308-95276330 CCTGCTCAGCCTCTGGGGCCTGG + Exonic
934844763 2:97655691-97655713 CCTTCTTTGCCCCCGGACCCTGG - Intergenic
935351503 2:102155020-102155042 ACTGCTGAGCTCCTGGAGCCAGG + Intronic
935714399 2:105927287-105927309 CCTGCTCAGCCTCTGCAGTCTGG - Intergenic
936533028 2:113290199-113290221 CCTGCTGGGCCCCAAGAGCCAGG - Intergenic
937289321 2:120772563-120772585 CCTGCTGAGCCCTTCGGGCCTGG + Intronic
937470389 2:122169365-122169387 CCTGCTTTCCTCCTGGAGTCTGG + Intergenic
938370372 2:130764456-130764478 CCCGCTCAGCCCCTGCTGCCCGG + Exonic
938804995 2:134797847-134797869 CCTACTCAGCCCCTGAACCCTGG + Intergenic
940597675 2:155815762-155815784 CCTGCCTAGGCCTTGGAGCTGGG + Intergenic
943757660 2:191573695-191573717 CCTCATTAGCCCCAGGAGACTGG + Intergenic
946425777 2:219595580-219595602 CATGGGTAGCCCCTGTAGCCAGG - Intergenic
948371650 2:237493547-237493569 CGTGCTGAGCCCACGGAGCCCGG + Intronic
948674451 2:239588820-239588842 ACTGCTCAGCCTCTGCAGCCTGG + Intergenic
948769955 2:240246625-240246647 CCTGCTCAAACCCTCGAGCCCGG + Intergenic
948903276 2:240966616-240966638 GCTGAAAAGCCCCTGGAGCCAGG + Intronic
1168924322 20:1566797-1566819 CCTTCTTAGCCCCAGGGGCAGGG + Intronic
1168931921 20:1630847-1630869 CCTGCTTAGCCCCAGAAGTAAGG + Intronic
1171425133 20:25044152-25044174 CCTGCCTGGAGCCTGGAGCCTGG - Intronic
1171775523 20:29363822-29363844 CCTACTCAGCCCCTGCAGCTGGG - Intergenic
1172579696 20:36037105-36037127 CCTGCTCAGCCCCTGGGGTGGGG - Intergenic
1172697377 20:36831962-36831984 CCTGCTTAGGCACTGGAGGCAGG + Intronic
1173590636 20:44222141-44222163 CCTGGTTAGCCCTGGGAGGCAGG + Intergenic
1174604872 20:51754085-51754107 CCTGGCCAGGCCCTGGAGCCTGG + Intronic
1174721249 20:52815148-52815170 CCTGTTTTGACTCTGGAGCCAGG - Intergenic
1175941651 20:62540097-62540119 CCTGCTGTGCCCCAGGAGCGAGG + Intergenic
1175986220 20:62765324-62765346 CCTGCTTCCTCCCTGGAGCTGGG + Intergenic
1176201667 20:63863636-63863658 ACTGCGTGTCCCCTGGAGCCAGG + Intergenic
1178514503 21:33235365-33235387 CCTGCTGAGCCCCAGGTGACAGG - Intronic
1178544248 21:33479925-33479947 CCACCTCAGCCCCGGGAGCCCGG + Exonic
1179548047 21:42125318-42125340 CCTGCTTGGAGCCTGGAGCTGGG + Intronic
1179666760 21:42918162-42918184 CAAGGTTACCCCCTGGAGCCTGG - Intergenic
1179829153 21:43985144-43985166 CCAGCTTAGGCCCAGGTGCCAGG + Exonic
1180465326 22:15604963-15604985 CCAGCTCAGCCCCAGGATCCAGG + Intergenic
1180874722 22:19169800-19169822 ACGGCTTAGCTCCTGGAGCCGGG + Intergenic
1180996499 22:19968411-19968433 TGTGCCTAGCCCCTGGGGCCAGG - Intronic
1181436946 22:22916606-22916628 GATGCTTACCCCCTGGACCCTGG + Intergenic
1181675474 22:24448643-24448665 CCTGGTGAGTCCCTGTAGCCTGG - Intergenic
1181746182 22:24956407-24956429 CCTGCTTTGCCACTGCTGCCTGG - Intronic
1182552376 22:31107249-31107271 CCTGCTTTCCCCCTGGCGCCGGG - Intronic
1183103383 22:35597888-35597910 CCTGCTAAGCACCTGCAGGCTGG - Intergenic
1183383154 22:37500519-37500541 CCTTCTCAGCTCCTGGAGCCTGG - Intronic
1184736000 22:46398170-46398192 CGTGCCTGTCCCCTGGAGCCAGG - Intronic
1185015152 22:48338694-48338716 CCAGCTCAGCCACTGGAGTCTGG - Intergenic
1185088649 22:48754017-48754039 CCTCCTGAGGCCCTGGGGCCAGG + Intronic
950207754 3:11093469-11093491 CTTGCTTTGCCCCCTGAGCCTGG - Intergenic
950486297 3:13275856-13275878 CCTGCTGTGGCCCAGGAGCCGGG - Intergenic
950628829 3:14267872-14267894 CCTGCCTGAGCCCTGGAGCCTGG + Intergenic
952135149 3:30410735-30410757 CTAGCATAGCTCCTGGAGCCTGG - Intergenic
952611659 3:35216915-35216937 CCTGCTAAGCCCCCTTAGCCTGG - Intergenic
954390852 3:50267346-50267368 CCTGCTGAGCCCCTGGAGCTGGG + Intergenic
956079229 3:65539846-65539868 CCTTCTTAGCCTCAGGAACCTGG + Intronic
956170688 3:66431289-66431311 GTTGCTCAGCCCCTGGAGTCTGG - Intronic
956696564 3:71923598-71923620 CTTTCTTGGCCTCTGGAGCCTGG + Intergenic
957206503 3:77205463-77205485 CCTTCTCTGCTCCTGGAGCCTGG + Intronic
961902242 3:130224327-130224349 CCTGTTCATCCCCTGGAGCTGGG + Intergenic
962399338 3:135043828-135043850 CCTGCCTATTCCCTGAAGCCTGG + Intronic
962421214 3:135230496-135230518 CTTGTTTAGTCCCTGAAGCCTGG - Intronic
968487399 4:870432-870454 CCCGCTTCGCTCCAGGAGCCTGG + Intronic
968945744 4:3662724-3662746 CCGGCTCTGCCCCTGCAGCCTGG - Intergenic
968966334 4:3770803-3770825 CCAGCTTCTCCCCTGCAGCCTGG - Intergenic
969714367 4:8861219-8861241 CCCGCTGGGGCCCTGGAGCCAGG - Intronic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
972336620 4:38112762-38112784 GCTCCATAGTCCCTGGAGCCAGG - Intronic
972824187 4:42737209-42737231 CCTGCTTAGCCCCATGAGGGTGG - Intergenic
973052299 4:45610806-45610828 CTTGCTTAGTCTCTGGAGGCAGG - Intergenic
973620622 4:52722250-52722272 CCTGCTCTGGACCTGGAGCCAGG - Intergenic
973713346 4:53650866-53650888 CCTGCATCTCCCTTGGAGCCAGG + Intronic
976595595 4:86892282-86892304 CCCTCCGAGCCCCTGGAGCCCGG - Intronic
980392939 4:132169730-132169752 ACTTCTTACCTCCTGGAGCCAGG - Intergenic
980701873 4:136442316-136442338 CCTGCTTTGATCTTGGAGCCAGG + Intergenic
985315965 4:188659226-188659248 CCTGCCCAGCGCCTGCAGCCCGG - Intergenic
985689325 5:1298435-1298457 CCTGCAAAGGCCCTGGGGCCGGG + Intergenic
985812188 5:2098356-2098378 CATGATCAGCCCCTGGTGCCAGG + Intergenic
986606560 5:9528935-9528957 CCTGCCTGGTCTCTGGAGCCAGG - Intronic
987076135 5:14383371-14383393 CATGCATGGCCCCTGGAGCTGGG - Intronic
988444672 5:31272079-31272101 TCTGCTGAGCCCCCAGAGCCTGG - Intronic
990557409 5:56951085-56951107 CCTAGTTCGCCCCTGGGGCCCGG + Intronic
991000353 5:61776697-61776719 CCTGCAGGGCCCCTGGAGACAGG + Intergenic
991113673 5:62929214-62929236 CCTGCTTGGGGCCTGGAACCTGG + Intergenic
993835077 5:92810050-92810072 TCTGCATAGCCCCTGGAGTCAGG - Intergenic
994149546 5:96432386-96432408 CCTGCTTAGCCCCTTGCATCAGG + Intronic
994344507 5:98668835-98668857 CATGCTAAGCTCCTTGAGCCAGG + Intergenic
995521800 5:113014451-113014473 CCTGCTAAGCCCCTGGATGATGG + Exonic
995598667 5:113773691-113773713 CCTGCTTAGCCACTGAAGCTAGG + Intergenic
997297606 5:132777505-132777527 TCTGCGTGTCCCCTGGAGCCTGG + Intronic
999210770 5:149886498-149886520 TCTGGTCAGCCTCTGGAGCCAGG - Intronic
999367951 5:151035123-151035145 GCTGGTTAGGCCCTGGATCCAGG - Intronic
999381877 5:151127043-151127065 CCTGCTTGGACTCTGCAGCCAGG - Intronic
1001767060 5:174258254-174258276 CCTGCTTAGACCTTGAAGCTAGG + Intergenic
1002683817 5:180991060-180991082 ACAGCTCCGCCCCTGGAGCCTGG - Intronic
1003977092 6:11354699-11354721 TCTTCTTAGACCCTGGTGCCAGG + Intronic
1004350816 6:14888814-14888836 CCTGCTTCACCCCTGAAGCTTGG + Intergenic
1005310035 6:24550288-24550310 CCGGGTTAGGCCCTGGAGACTGG - Intronic
1006909493 6:37554950-37554972 CCTGCTTCCCCCCAGGAGCAAGG + Intergenic
1007309403 6:40933596-40933618 CCTGCTTATTCCCTGTTGCCTGG - Intergenic
1009349931 6:62661548-62661570 CCTGGTCTGCCTCTGGAGCCTGG + Intergenic
1010435609 6:75826600-75826622 CATCCTTGTCCCCTGGAGCCTGG - Intronic
1013218727 6:108056641-108056663 CCAGCTTAGCTTCTGGAGGCAGG - Intronic
1019151714 6:170010875-170010897 CCTGCTGGGACCTTGGAGCCTGG + Intergenic
1019483022 7:1274998-1275020 CCTGCATGGGTCCTGGAGCCGGG + Intergenic
1019548192 7:1588558-1588580 CCTGCCTCGCCACTGGAGCCGGG - Intergenic
1019744919 7:2694257-2694279 CCTGCCTCGCCGCTGGAGCTGGG + Intronic
1022044658 7:26613339-26613361 CTTGCATAGCCCCTGCAGCTTGG - Intergenic
1022525294 7:31033309-31033331 CATGCTGAGCCCCTGCAGCTAGG + Intergenic
1023289543 7:38655417-38655439 CCTGCTGAGCCCCCTGAACCTGG + Intergenic
1023823145 7:43991207-43991229 CCTGCTGTCCCCCTGTAGCCTGG + Intergenic
1023922455 7:44640040-44640062 CCAGCCTAGGCCCTGGAGACAGG - Intronic
1025635698 7:63317701-63317723 TCTGCTTACTGCCTGGAGCCTGG + Intergenic
1025646998 7:63430479-63430501 TCTGCTTACTGCCTGGAGCCTGG - Intergenic
1025813332 7:64889098-64889120 CCTGCTTGGCTCCCGGAGCCCGG - Intronic
1029751409 7:102544645-102544667 CCTGCTGTCCCCCTGTAGCCTGG + Intronic
1029769361 7:102643738-102643760 CCTGCTGTCCCCCTGTAGCCTGG + Intronic
1032084490 7:128876930-128876952 CCTGCCTGGACACTGGAGCCTGG - Exonic
1032499156 7:132386749-132386771 CCTGCTGAGGCTCTCGAGCCAGG - Intronic
1033483562 7:141765227-141765249 ACTGCTTTGCCCCTGGTCCCTGG + Intronic
1034274382 7:149817678-149817700 CCTGGTCAGCCCCTCGGGCCTGG + Intergenic
1034329339 7:150269324-150269346 CCAGCCTACTCCCTGGAGCCAGG + Intronic
1034668715 7:152840536-152840558 CCAGCCTACTCCCTGGAGCCAGG - Intronic
1035302979 7:157909557-157909579 CCTGCTCAGCCCCTTCAGCGCGG + Intronic
1039458380 8:37723502-37723524 ACTCCTTAGCCCCAGGACCCTGG + Intergenic
1045971270 8:108082454-108082476 CCATCTGAGCCCCCGGAGCCAGG + Intronic
1047051463 8:121117743-121117765 CCTGGATAGCCTCTGGAGCTAGG + Intergenic
1047931064 8:129728566-129728588 CCTGCTTAGCCCCTGGGGGGAGG - Intergenic
1047932925 8:129748805-129748827 CCTGCATGGCCCCTGGATACTGG - Intronic
1049250898 8:141588520-141588542 CCTGCTTGGCCCCTGATGCAGGG - Intergenic
1049278552 8:141732233-141732255 CCTGCCCCGCCCCTGTAGCCTGG + Intergenic
1049318184 8:141980808-141980830 TCTGCTTAGTGCCTGTAGCCAGG - Intergenic
1049424119 8:142530489-142530511 CCTGCTTTGCTCCCTGAGCCAGG + Intronic
1049474157 8:142789158-142789180 CCCACTCAGCCCCTGGAGCTGGG + Intergenic
1051618996 9:19032997-19033019 CCTGCCAAGACCCTCGAGCCTGG - Exonic
1052940289 9:34127075-34127097 CCTGTCCAGCCCTTGGAGCCAGG - Intronic
1053415563 9:37944955-37944977 CAGGCTGAGCCCCTGGAGGCTGG + Intronic
1054341576 9:63868266-63868288 CCTGTACAGCCCATGGAGCCAGG + Intergenic
1056505281 9:87252407-87252429 CATGCTTAACCTCTGGAGCCAGG + Intergenic
1056617440 9:88180520-88180542 CCTCATTGCCCCCTGGAGCCAGG - Intergenic
1057606207 9:96499380-96499402 CCTGCCTTGCCTCTGGTGCCGGG - Intronic
1059332719 9:113546120-113546142 CCTGCTTTGCACCTGGAGCCCGG + Intronic
1060031348 9:120217493-120217515 CCTGCTCTGCCCCTAGTGCCTGG + Intergenic
1061081757 9:128374997-128375019 CCTGCTTAGCACCAGCAGACTGG - Intronic
1061193762 9:129096393-129096415 CCTGCCAAGGCCCTGCAGCCAGG - Intronic
1062408784 9:136410892-136410914 CTTGCTTTGCGCCTCGAGCCCGG + Intronic
1189290100 X:39878709-39878731 ACTGCTTTGTCCCTGGGGCCTGG - Intergenic
1190076737 X:47322455-47322477 CCTGCTTGTCCCCAGGAGCAGGG - Intergenic
1190280300 X:48924776-48924798 CCTGCTCAGCCCCTTTATCCTGG + Intronic
1190327956 X:49218396-49218418 CCTGCCCTGCCCCTGGGGCCAGG - Intronic
1190430182 X:50371371-50371393 CCTGCTCAGCACCTGCTGCCAGG - Intronic
1190937360 X:55008749-55008771 CCAGGGTAGCCCCTGAAGCCAGG - Exonic
1192204967 X:69089565-69089587 CCTGCTTTGCCCCAGAGGCCTGG - Intergenic
1199343266 X:146707944-146707966 CCTGCTTAGCCCCAGGGGGTGGG + Intergenic
1199425271 X:147693533-147693555 CCTGCTCAGGCCATGGAGCTGGG + Intergenic
1200059233 X:153476933-153476955 TCTGCTGAGCCCCTGAAGGCTGG + Intronic
1200068553 X:153516902-153516924 CCTCCACAGCCCCTGGAGCTGGG + Intergenic
1200119905 X:153785261-153785283 TCTGCTTAGGCCCTGGCTCCTGG - Intronic