ID: 1162792254

View in Genome Browser
Species Human (GRCh38)
Location 19:13069221-13069243
Sequence TTGGGTGGCCCTGAACTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162792239_1162792254 24 Left 1162792239 19:13069174-13069196 CCAGGGAGCGCTGGGAGCCACAG No data
Right 1162792254 19:13069221-13069243 TTGGGTGGCCCTGAACTTGGGGG No data
1162792245_1162792254 0 Left 1162792245 19:13069198-13069220 CCCTGAAGAGACTGGGAGGGTGG No data
Right 1162792254 19:13069221-13069243 TTGGGTGGCCCTGAACTTGGGGG No data
1162792247_1162792254 -1 Left 1162792247 19:13069199-13069221 CCTGAAGAGACTGGGAGGGTGGT No data
Right 1162792254 19:13069221-13069243 TTGGGTGGCCCTGAACTTGGGGG No data
1162792241_1162792254 7 Left 1162792241 19:13069191-13069213 CCACAGTCCCTGAAGAGACTGGG No data
Right 1162792254 19:13069221-13069243 TTGGGTGGCCCTGAACTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162792254 Original CRISPR TTGGGTGGCCCTGAACTTGG GGG Intronic