ID: 1162792488

View in Genome Browser
Species Human (GRCh38)
Location 19:13070238-13070260
Sequence CTGAGCACCCTGTCAGCTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162792488_1162792491 2 Left 1162792488 19:13070238-13070260 CCCCGAGCTGACAGGGTGCTCAG 0: 1
1: 0
2: 1
3: 10
4: 122
Right 1162792491 19:13070263-13070285 ACCTTCCCCCGTCACATCCCTGG 0: 1
1: 0
2: 1
3: 14
4: 175
1162792488_1162792500 21 Left 1162792488 19:13070238-13070260 CCCCGAGCTGACAGGGTGCTCAG 0: 1
1: 0
2: 1
3: 10
4: 122
Right 1162792500 19:13070282-13070304 CTGGTGTCCCGAGGTGCCTGCGG 0: 1
1: 0
2: 3
3: 10
4: 172
1162792488_1162792503 30 Left 1162792488 19:13070238-13070260 CCCCGAGCTGACAGGGTGCTCAG 0: 1
1: 0
2: 1
3: 10
4: 122
Right 1162792503 19:13070291-13070313 CGAGGTGCCTGCGGCCCTATCGG 0: 1
1: 0
2: 0
3: 1
4: 45
1162792488_1162792497 12 Left 1162792488 19:13070238-13070260 CCCCGAGCTGACAGGGTGCTCAG 0: 1
1: 0
2: 1
3: 10
4: 122
Right 1162792497 19:13070273-13070295 GTCACATCCCTGGTGTCCCGAGG 0: 1
1: 0
2: 0
3: 12
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162792488 Original CRISPR CTGAGCACCCTGTCAGCTCG GGG (reversed) Intronic
900933604 1:5751873-5751895 CTGAAAACCCTGCCAGCTCCTGG + Intergenic
900957010 1:5892372-5892394 CTCAGCATGCTGTCAGCTCTGGG + Intronic
902797236 1:18807658-18807680 CTGAGCACCCTGTCACTGAGGGG - Intergenic
902979975 1:20115613-20115635 CTGTGCACCCTGTCTGCTCCAGG - Exonic
903500669 1:23798674-23798696 CAGAGCGGCCTGTCAGCTCCTGG + Exonic
908478248 1:64510289-64510311 CTTTGCACCCTTTCAGCTCTAGG + Intronic
913054274 1:115143093-115143115 CTCAGCTTCCTGTCAGCTGGTGG + Intergenic
915067465 1:153238528-153238550 CTGAGCACCCTGCCAGTCCTAGG + Intergenic
915738338 1:158098770-158098792 CTGAGCACCCTGTCTTCAAGCGG + Intronic
920399023 1:205665648-205665670 CTGGGCATCCTGTCAGCTTGGGG - Intronic
920751756 1:208684857-208684879 TTGAGGACCCTGTCAACTCTAGG - Intergenic
1065188274 10:23189785-23189807 TTGAGCACCCAGTGAGCTCATGG - Intergenic
1068097961 10:52515700-52515722 TTGAGCACCCTGACATCTCTAGG + Intergenic
1070753750 10:78978911-78978933 CTGAGCACCTAGTCAGTTCTGGG - Intergenic
1070807210 10:79277639-79277661 CTGAGATCCCTGTCAGCCCCTGG - Intronic
1071737421 10:88317780-88317802 CTGGGCACTCTGTCAGGTCCTGG - Intronic
1071762402 10:88623339-88623361 CTGAGTGTCCTGTCAGCTCATGG + Intergenic
1073339196 10:102732191-102732213 CGGATCACCATGTCAGCTCCTGG + Exonic
1074415410 10:113263014-113263036 CTCAGCACCTAGTCTGCTCGAGG + Intergenic
1075918794 10:126192363-126192385 TTGAGCACCCTGTCTGCTGGAGG + Intronic
1076358590 10:129870501-129870523 CTCTGGACCCTGGCAGCTCGGGG - Intronic
1077020684 11:415949-415971 CTGAGCACCCTCTCAGCAGCAGG + Intronic
1077418279 11:2436167-2436189 CTGATCACCCATTCAGCTCCTGG + Intergenic
1081935162 11:46899100-46899122 CTGAGCATCCTGCCTGCTTGAGG - Intronic
1082011092 11:47449898-47449920 ATGAGGACCCTTTCAGCCCGGGG - Intergenic
1082174797 11:49048196-49048218 CTGGGCACCATGGCAGCTCCCGG - Intergenic
1082657619 11:55872620-55872642 CTGAGCACCATGGCCGCTCCCGG - Intergenic
1084486418 11:69450789-69450811 CGGAGCAGCCTGTCAACTCCAGG - Intergenic
1085030908 11:73270411-73270433 CTGTGCCCCCCGTCAGCTCCTGG - Intronic
1086007013 11:82048890-82048912 CAGAGCACCAAGTCAGCTCTTGG + Intergenic
1086690979 11:89787892-89787914 CTGGGCACCGTGGCAGCTCCCGG + Intergenic
1087943192 11:104126232-104126254 CAGAGCAGCCTGTAAGCTGGAGG + Intronic
1088926920 11:114312145-114312167 CTGAGCACGCAGTCAGCCGGGGG - Exonic
1089303789 11:117514328-117514350 CTGAGGGCCCTGTCACCTGGGGG - Intronic
1089613713 11:119683785-119683807 CTGACCACCCTATGAGCTCCAGG + Intronic
1091310737 11:134573578-134573600 CTCAGCACCCTTTCTGCTCCAGG + Intergenic
1097309523 12:58103064-58103086 CAGAGCACCCTGTCAGAAGGAGG - Intergenic
1098477443 12:70921144-70921166 CTGAGCATTCTGGCTGCTCGGGG + Intergenic
1098574755 12:72028537-72028559 CTCAGCACACAGTCAGCTCATGG + Intronic
1104810599 12:131617944-131617966 CTGTGCACCCTCCCAGCTCTGGG + Intergenic
1105404207 13:20119878-20119900 CTGTGAGCCCTGTCAGTTCGGGG + Intergenic
1114170107 14:20263725-20263747 CTCAGCACACTCTCAGCTCCTGG - Intronic
1118736505 14:68705071-68705093 CTGAGCAACCTTTCAGCTCCCGG - Intronic
1118780691 14:69005793-69005815 CTGAGCACCCGGTAAGTCCGTGG - Intergenic
1121731113 14:96187832-96187854 CTGAGCACCTGCTCAGCTCCAGG + Intergenic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1125504001 15:40256458-40256480 CAGAGGACCCTGTCACCTCCAGG - Intronic
1125605933 15:40939953-40939975 CTGAGCACCTTGTCTGCCCAGGG + Intergenic
1126434985 15:48627810-48627832 CTCAGCACCCTTCCAGCTCCAGG + Intronic
1128459639 15:67856872-67856894 CTTAGCACCTTGGCAGCCCGAGG + Intergenic
1129752907 15:78078093-78078115 CTGAGCACCCACTCAGCACCAGG - Intronic
1130577541 15:85105795-85105817 CTGAGCACCCAGTAAGCATGAGG + Intronic
1131257499 15:90871853-90871875 CGGAGCGCCCTGTCTGCTCCCGG - Intronic
1132271095 15:100526410-100526432 ATGAGCACTCTGCCAGCTCCTGG + Intronic
1132586102 16:706249-706271 CTGACCACCCTGTCTCCTCTGGG - Intronic
1139643560 16:68310938-68310960 CTGAGCACTGTGGGAGCTCGCGG + Exonic
1139923331 16:70472897-70472919 CTGAGCCGCCTGTCAGTTCATGG - Intronic
1142189230 16:88710043-88710065 CTGAGCAGCCTGGCCCCTCGAGG + Intronic
1142303837 16:89274704-89274726 CTGAGCACCCGGGAAGCTCCTGG + Intronic
1143390333 17:6556175-6556197 CTGCGCCCCCGGTCACCTCGGGG - Intronic
1143738742 17:8935705-8935727 CTGAGCTCCCGGACAGCTCCTGG + Intronic
1145960780 17:28885443-28885465 CTGAGCACCTTCTCAGTTTGAGG - Intronic
1147644988 17:42028076-42028098 CTGTGCTCTCTGTCAGCTCCAGG - Exonic
1148822627 17:50368390-50368412 CTGATCACCCTTTCAGCCCCAGG - Intronic
1152235448 17:79136066-79136088 CTGAGCTCCCTGGCATCCCGTGG + Intronic
1152385822 17:79974122-79974144 CTGATCACCCAGACAGCTGGCGG + Intronic
1152683440 17:81682003-81682025 CTGTGCTCCCTCTCAGCTCAGGG + Intronic
1153437046 18:5078732-5078754 ATGAGGACTCTGTCAGCTCAAGG + Intergenic
1155586063 18:27366849-27366871 AAGAGCACTCTGTCAGCTCTGGG + Intergenic
1156455657 18:37292247-37292269 CTGAACACCTTGTCAGTTCCAGG + Intronic
1160419262 18:78732846-78732868 CTGGGCACCCTGTGGGCCCGTGG - Intergenic
1160734625 19:656916-656938 CTGGGCTCCCGGTCAGCTGGCGG - Intronic
1162792488 19:13070238-13070260 CTGAGCACCCTGTCAGCTCGGGG - Intronic
1163554761 19:17985525-17985547 ATGAGCACCCTGTCAGCAAGGGG - Intronic
925322682 2:2987741-2987763 CTGAGCACCCTGTCAGAGGGTGG - Intergenic
927685781 2:25169303-25169325 CAGACCACCCTGCCAGCTCATGG - Intergenic
932338202 2:70943087-70943109 CTGAGCACCCAGTGAGCCTGGGG + Intronic
934588684 2:95527275-95527297 CTGGGCACCATGGCAGCTCTCGG + Intergenic
934697471 2:96410409-96410431 CTGAGGACCCTGTAAGCAAGTGG + Intergenic
940810710 2:158239525-158239547 CTGAGCACACGGTCAACTCTTGG - Intronic
942276374 2:174326706-174326728 CGGAGCGCCCTGTGAGCGCGGGG - Intergenic
945188999 2:207166802-207166824 CTCTGCACCCTGGCAGCCCGTGG - Intronic
948270074 2:236667427-236667449 CTGAGCAGCCAGACAACTCGAGG + Intergenic
948825349 2:240571143-240571165 CTGAACACCCTGGCAGCCCAGGG + Intronic
948876638 2:240833030-240833052 CAGAGCTCCCTGTCAGGCCGAGG + Intergenic
1174001884 20:47380801-47380823 CTGTGCACCCTGTTAGCTTGAGG + Intergenic
1175809862 20:61852166-61852188 CTGTGTGCCCTGTCAGCTCTTGG - Intronic
1175871561 20:62211736-62211758 CTGGGCACCCTGAGAGCTCAGGG + Intergenic
1178922021 21:36744998-36745020 CTGAGCACACTGCCAGCCAGCGG + Exonic
1179513581 21:41891532-41891554 CAGAGCCCCCTGACAGCTGGGGG - Intronic
1180050234 21:45327708-45327730 CTGACCACCGTGCCAGCTCCCGG - Intergenic
1181086366 22:20441329-20441351 CTGAGTGCCCTGTTAGCTTGTGG + Intronic
1183513525 22:38249813-38249835 CTGACCAGCCTGTCAGCAGGTGG - Intronic
1184189627 22:42886077-42886099 CTGAGTACCCTGAGAGCTCCCGG - Intronic
1184469856 22:44690295-44690317 CTGAGCACCCAGTCTGATGGAGG + Intronic
1185276792 22:49953403-49953425 CTGAACACCCTGTCCGCTCTTGG - Intergenic
952849899 3:37719342-37719364 CAGATCAACCTGTCAGCTCATGG - Intronic
958004906 3:87798335-87798357 CTGACCACCCTCTCTGCTCTGGG + Intergenic
958946505 3:100368505-100368527 CTGAACATCCTGTCAGCTGTTGG - Intronic
961560190 3:127723445-127723467 CTGGGCAGCCTGTCAGTTCCAGG - Intronic
974568316 4:63607922-63607944 CAGAGCACCATTTCAGCTCTGGG - Intergenic
982448197 4:155519677-155519699 CTGAGCTCCTTATCAGCTTGTGG + Intergenic
985824191 5:2180600-2180622 CTGTTCACCCTGAGAGCTCGGGG - Intergenic
986502751 5:8417504-8417526 CTGAGCCTCCTGTGAGCTCATGG - Intergenic
991006752 5:61835460-61835482 CTGAGCACCCTCTCAGATTGTGG - Intergenic
998152229 5:139764122-139764144 CTGAGCACACAGTCAGCGGGTGG + Intergenic
1002538487 5:179891318-179891340 CTGAGCCCACTGACACCTCGGGG + Intronic
1004393457 6:15228263-15228285 CTGAGCACCCTGGGAGGCCGAGG + Intergenic
1008525470 6:52403238-52403260 CTGAGCACCCTGTCGGTCAGCGG + Exonic
1010218866 6:73429877-73429899 CTGACCACCCTGTTACTTCGTGG + Intronic
1010512934 6:76743135-76743157 CTGAGCATGCTGTCAGTTCCTGG - Intergenic
1019620647 7:1990281-1990303 CTCAGCACCCTCTCATCTCTTGG - Intronic
1019669918 7:2271956-2271978 ATGAACTCCCTGTCAGCTGGAGG + Exonic
1026837270 7:73647415-73647437 CTGGGCCCCCTCTCAGCTCCTGG + Intergenic
1033483291 7:141762679-141762701 CTGTGCACCCTGTCACATCTGGG - Intronic
1035227945 7:157443811-157443833 CTGCGCACCCTGACAGCACATGG - Intergenic
1035705381 8:1670720-1670742 CTGTGCATCCTGTGAGCTGGCGG + Intronic
1040385496 8:46912576-46912598 CTGAGCACCTTCTCATCTCCTGG + Intergenic
1041731569 8:61068463-61068485 CTGAACACCCTGCAAGCTTGAGG - Intronic
1042399840 8:68332208-68332230 CTCAGCACCCTGGCAACCCGCGG - Intronic
1049031183 8:140038944-140038966 CTGAGCTCCCTGTGAGTTCCAGG - Intronic
1049672314 8:143875394-143875416 CTGAGCAGCCTGTCAGCAGCAGG - Intronic
1053000005 9:34572546-34572568 CTGAGCCCCTTGTCAGCACAAGG + Intronic
1054785135 9:69203139-69203161 CTGAGAACCCAGGCAACTCGGGG - Intronic
1058690644 9:107517547-107517569 CTGAGCACCATGACACCTTGTGG + Intergenic
1060847275 9:126847446-126847468 CTGAGCAGCCTGGCAGCATGAGG - Intergenic
1061321864 9:129835716-129835738 CTGAGCTCCCTGGGGGCTCGTGG + Intronic
1061419377 9:130464865-130464887 CTGAGCACCCACTCAGCTCCAGG + Intronic
1061573849 9:131494177-131494199 CTGACCACCCTGGCACCTCCAGG - Intronic
1061721839 9:132556743-132556765 CTCAGTTCCCTGACAGCTCGTGG - Intronic
1189740489 X:44112692-44112714 CTGAGCTCCCTTTCATCTCAAGG + Intergenic
1190550477 X:51574772-51574794 CTGAGAACCTTGTCAGCCTGTGG - Intergenic
1195702067 X:107713112-107713134 TTGAGCACCCTGTCAGTGCCAGG - Intergenic
1197727123 X:129783728-129783750 CTGAGCACCCTGTGAGCTCTAGG - Intronic