ID: 1162792631

View in Genome Browser
Species Human (GRCh38)
Location 19:13070938-13070960
Sequence GCATCCACACGCGTGTGCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 80}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162792629_1162792631 -1 Left 1162792629 19:13070916-13070938 CCTGGGCTGGGTACGCGCATGCG 0: 1
1: 0
2: 1
3: 5
4: 41
Right 1162792631 19:13070938-13070960 GCATCCACACGCGTGTGCACGGG 0: 1
1: 0
2: 1
3: 7
4: 80
1162792625_1162792631 12 Left 1162792625 19:13070903-13070925 CCTCTCGGCTGTCCCTGGGCTGG 0: 1
1: 0
2: 3
3: 28
4: 299
Right 1162792631 19:13070938-13070960 GCATCCACACGCGTGTGCACGGG 0: 1
1: 0
2: 1
3: 7
4: 80
1162792628_1162792631 0 Left 1162792628 19:13070915-13070937 CCCTGGGCTGGGTACGCGCATGC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1162792631 19:13070938-13070960 GCATCCACACGCGTGTGCACGGG 0: 1
1: 0
2: 1
3: 7
4: 80
1162792624_1162792631 13 Left 1162792624 19:13070902-13070924 CCCTCTCGGCTGTCCCTGGGCTG 0: 1
1: 0
2: 3
3: 28
4: 258
Right 1162792631 19:13070938-13070960 GCATCCACACGCGTGTGCACGGG 0: 1
1: 0
2: 1
3: 7
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162792631 Original CRISPR GCATCCACACGCGTGTGCAC GGG Intronic
900277684 1:1842627-1842649 GCATGCACATGTGTGTGCAGTGG + Intronic
900471695 1:2858159-2858181 GCATCTCCACCCGTGGGCACAGG - Intergenic
900570099 1:3353905-3353927 GCATCCACATGTGTGTGCCAAGG - Intronic
900882449 1:5391708-5391730 ACACCCACGCGCGAGTGCACAGG + Intergenic
902338716 1:15768621-15768643 GCATCCACAGGTAGGTGCACAGG + Exonic
905925318 1:41745550-41745572 GCATCCACAGTCGAGAGCACAGG + Intronic
917187725 1:172379556-172379578 GCATGCACACGCATGGGCATAGG - Intronic
920378791 1:205523666-205523688 GCACGCACAAGGGTGTGCACAGG + Exonic
923558390 1:235020126-235020148 GCATCCCCACGCCTGGGCAAGGG + Intergenic
1064969113 10:21046015-21046037 ACACACACACGTGTGTGCACTGG + Intronic
1075486902 10:122829731-122829753 GCTTCCTCAGGCGTGTGCTCGGG - Intergenic
1075745122 10:124721767-124721789 GCACTCACACACGTGTTCACAGG - Intronic
1076240674 10:128903370-128903392 ACACACACACACGTGTGCACGGG + Intergenic
1076731175 10:132439770-132439792 GCATCCACATGCATGCACACAGG - Intergenic
1077147008 11:1050857-1050879 ACACCCACACCCGTGTGTACAGG + Intergenic
1078474988 11:11622216-11622238 GCCTCCACCCGCGCCTGCACAGG + Intergenic
1079077232 11:17391495-17391517 ACATCCACAGGGGTCTGCACTGG + Intergenic
1084540072 11:69780914-69780936 AGATCTGCACGCGTGTGCACAGG - Intergenic
1087355395 11:97087081-97087103 ACATCCACACATATGTGCACAGG - Intergenic
1090804573 11:130194803-130194825 ACATCCACACACATCTGCACAGG - Intronic
1091664657 12:2410561-2410583 GCATGCACACGCACATGCACAGG - Intronic
1102057439 12:109907284-109907306 GCTTCCACACCTCTGTGCACTGG + Intronic
1103082894 12:118039483-118039505 GAATGCAAACGTGTGTGCACAGG + Intronic
1104981432 12:132574649-132574671 GTGTTCACACGCGTGTGCACGGG + Intronic
1108676167 13:52739433-52739455 GCATCCACAGGCGGGTGCGGAGG - Intronic
1112754098 13:102611220-102611242 ACATCCACACACATGTGCACAGG - Intronic
1114667593 14:24389144-24389166 GCAACCACATGAGTGTGCCCAGG - Intergenic
1119854107 14:77886501-77886523 GCATCCTCATACCTGTGCACGGG - Intronic
1122323152 14:100867432-100867454 GCACCCACACACGTGCACACCGG - Intergenic
1122621917 14:103063046-103063068 GCTTCCATCCGCGTGAGCACTGG - Intergenic
1123147409 14:106146438-106146460 GCATCAATATGCGTGTGTACAGG + Intergenic
1124239299 15:28016935-28016957 CCTTCCACACCCCTGTGCACAGG + Intronic
1125174635 15:36806866-36806888 GGACCCACACACCTGTGCACAGG + Intronic
1136620015 16:31422395-31422417 CCTTCCACAGGCTTGTGCACAGG + Intronic
1137000077 16:35221926-35221948 GAATCCACCCGCCTGTGCAGTGG - Intergenic
1137399418 16:48141253-48141275 CCATCAACACGCGTGTCCTCTGG + Exonic
1138928314 16:61618989-61619011 ACATGCACACACGTGTGAACAGG + Intergenic
1142866723 17:2795943-2795965 ACATGCACACGCATGGGCACAGG - Intronic
1144599183 17:16598000-16598022 GCATGCATACATGTGTGCACAGG - Intergenic
1144674978 17:17156191-17156213 GCAGGCACAGGCATGTGCACAGG - Intronic
1152287091 17:79419162-79419184 CCATACACACATGTGTGCACAGG - Intronic
1159869157 18:73740972-73740994 GCTTCCACACCCGTGTGTATTGG - Intergenic
1162792631 19:13070938-13070960 GCATCCACACGCGTGTGCACGGG + Intronic
1166758223 19:45207804-45207826 GCATACACACACATGTGCACAGG + Intronic
925288873 2:2733525-2733547 GCCTGCACACGCGTGTGCGGTGG - Intergenic
926080974 2:9986227-9986249 GCAGCAACAAGCCTGTGCACCGG + Exonic
931016083 2:57982348-57982370 CCATGCACACACATGTGCACCGG + Intronic
935093982 2:99926318-99926340 GCATGCACACCCGAGTACACTGG + Intronic
935350031 2:102144726-102144748 GCATCCACACCCTTGTACAAAGG - Intronic
939273503 2:139970407-139970429 GCTCCCACATGCGTGGGCACTGG - Intergenic
947746964 2:232512831-232512853 GCATGCGCACGTGTGTGCAGGGG + Intergenic
948596319 2:239081923-239081945 GCATCGTATCGCGTGTGCACAGG - Intronic
1171349105 20:24489260-24489282 GCATGCACACACGTGCTCACAGG + Intronic
1175720468 20:61283531-61283553 GCATTTACACGCGTGTGCTGTGG + Intronic
1176244799 20:64092321-64092343 ACAGCCACTCGCGTGTTCACAGG - Intronic
1180836532 22:18932504-18932526 GCACCCACACGCCTGCCCACAGG + Intronic
1182515323 22:30855427-30855449 GCAACCACACGCCTGTGCTGTGG - Intronic
1183493492 22:38128867-38128889 GCAGACACACACGTGTGCACTGG + Intronic
1183686227 22:39362752-39362774 GCTTGCACACCCCTGTGCACAGG - Intronic
1184868927 22:47220772-47220794 GCATACATGCACGTGTGCACAGG - Intergenic
1185058714 22:48594411-48594433 ACACACACACGAGTGTGCACAGG + Intronic
1185203778 22:49524766-49524788 GCATACACACACGTATCCACAGG + Intronic
1203286624 22_KI270734v1_random:157803-157825 GCACCCACACGCCTGCCCACAGG + Intergenic
961163189 3:124746797-124746819 GCATGCGCGCGCGTGCGCACTGG + Intergenic
967886363 3:194336398-194336420 GCATCCACACAGGGGTGCATGGG - Intergenic
981645217 4:146991357-146991379 CCATCCCCATGTGTGTGCACTGG + Intergenic
984605923 4:181786347-181786369 TCATGCACACACATGTGCACGGG + Intergenic
987086003 5:14468419-14468441 TCATCCACATGGGTGTTCACTGG + Intronic
987206843 5:15636060-15636082 CCATCCACACGAGTGGGCAATGG + Intronic
995815697 5:116165632-116165654 GCACACACACGCGTGTGCACAGG + Intronic
998394440 5:141809567-141809589 GTATGCACACGCGTGTGCTCTGG - Intergenic
1000982628 5:167832769-167832791 GCATACACACAGGAGTGCACTGG + Intronic
1019384261 7:745612-745634 ACATGTACACGTGTGTGCACAGG - Intronic
1019737017 7:2655615-2655637 GCATGCACACACGTAAGCACCGG + Intronic
1019898753 7:4003144-4003166 GTGTCCACATGCGTGTGCCCAGG - Intronic
1032578605 7:133081998-133082020 GCACCCACACGCGCGTGGAAGGG + Exonic
1035237358 7:157507402-157507424 GCCTCCACTCCCGTGTTCACTGG - Intergenic
1036687003 8:10918421-10918443 GCATGCACACATGTGTGTACTGG + Intronic
1040591026 8:48792240-48792262 GCACACACATGAGTGTGCACAGG + Intergenic
1047431777 8:124799093-124799115 GCCTGCAGACACGTGTGCACTGG + Intergenic
1050291839 9:4163222-4163244 GCATGTGCACGCATGTGCACTGG + Intronic
1055567263 9:77581767-77581789 GCATCCACAGGAATGTGGACTGG - Intronic
1059144626 9:111887525-111887547 GCATGCACACGTGTGTACACAGG - Intergenic
1060941699 9:127546301-127546323 GCATCCCCACGCCTGTCCACAGG + Intronic
1061330568 9:129889864-129889886 GTATGCGCACGCGTGTGTACTGG + Exonic
1061367850 9:130181859-130181881 ACCACCACACGCGTGCGCACAGG - Intronic
1062167197 9:135113780-135113802 GCTTCCACACCCGTGTGCTGGGG - Intronic
1191628987 X:63300642-63300664 ACACCCACACCAGTGTGCACAGG - Intergenic
1192141587 X:68651266-68651288 GCATGCACATGCATATGCACAGG + Intronic