ID: 1162795498

View in Genome Browser
Species Human (GRCh38)
Location 19:13085375-13085397
Sequence CCTTCCAAGCAACCACAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 163}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162795498_1162795501 -1 Left 1162795498 19:13085375-13085397 CCGTCCTGTGGTTGCTTGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 163
Right 1162795501 19:13085397-13085419 GCCTCTGTGTCCCAGTCCCCTGG 0: 1
1: 0
2: 1
3: 44
4: 399
1162795498_1162795506 13 Left 1162795498 19:13085375-13085397 CCGTCCTGTGGTTGCTTGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 163
Right 1162795506 19:13085411-13085433 GTCCCCTGGGAGCCTGAGCTCGG 0: 1
1: 1
2: 1
3: 39
4: 862
1162795498_1162795513 27 Left 1162795498 19:13085375-13085397 CCGTCCTGTGGTTGCTTGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 163
Right 1162795513 19:13085425-13085447 TGAGCTCGGGACACCTGGAGAGG 0: 1
1: 0
2: 1
3: 11
4: 178
1162795498_1162795511 22 Left 1162795498 19:13085375-13085397 CCGTCCTGTGGTTGCTTGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 163
Right 1162795511 19:13085420-13085442 GAGCCTGAGCTCGGGACACCTGG 0: 1
1: 0
2: 2
3: 18
4: 169
1162795498_1162795503 0 Left 1162795498 19:13085375-13085397 CCGTCCTGTGGTTGCTTGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 163
Right 1162795503 19:13085398-13085420 CCTCTGTGTCCCAGTCCCCTGGG 0: 1
1: 0
2: 4
3: 35
4: 396
1162795498_1162795507 14 Left 1162795498 19:13085375-13085397 CCGTCCTGTGGTTGCTTGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 163
Right 1162795507 19:13085412-13085434 TCCCCTGGGAGCCTGAGCTCGGG 0: 1
1: 0
2: 3
3: 37
4: 408
1162795498_1162795514 30 Left 1162795498 19:13085375-13085397 CCGTCCTGTGGTTGCTTGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 163
Right 1162795514 19:13085428-13085450 GCTCGGGACACCTGGAGAGGAGG 0: 1
1: 0
2: 2
3: 21
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162795498 Original CRISPR CCTTCCAAGCAACCACAGGA CGG (reversed) Intronic
900150788 1:1178584-1178606 CCTCCCAAGCAGCCCCAAGATGG + Intronic
901825767 1:11859838-11859860 CCCACCAAGCCAACACAGGATGG + Intergenic
902993390 1:20205311-20205333 CCTACCAGGTAGCCACAGGAAGG + Intergenic
903233402 1:21935373-21935395 CCTTCCCAGCACTCACAGGCTGG - Intronic
903782613 1:25831174-25831196 CCTTCAAAGCAAAAACAAGAGGG - Intronic
903829899 1:26168518-26168540 CCTGGCACGCAAGCACAGGAAGG + Intergenic
905743642 1:40394129-40394151 CCTCCCAAGAAACCATAGGATGG - Intronic
905856765 1:41319673-41319695 CCTTCCCCTCACCCACAGGAGGG - Intergenic
905884417 1:41484198-41484220 CCTTCCCTGCATGCACAGGAGGG + Exonic
906011136 1:42527768-42527790 CCTTCCCAGACACCACAGGAAGG - Intronic
907752022 1:57271798-57271820 CCTACCAATCATCCACAGGGTGG + Intronic
910671166 1:89774310-89774332 CCTGTCAAGCAACAACAGCATGG + Intronic
911044405 1:93616868-93616890 CCTTCCAGGCAGCCAGAGAAGGG - Intronic
913448015 1:118970519-118970541 CTTTCCAAGCAGCAGCAGGAAGG + Intronic
913599073 1:120405574-120405596 CTTTCTAAGTAAACACAGGAAGG - Intergenic
914088306 1:144474046-144474068 CTTTCTAAGTAAACACAGGAAGG + Intergenic
914310305 1:146460164-146460186 CTTTCTAAGTAAACACAGGAAGG - Intergenic
914591804 1:149112978-149113000 CTTTCTAAGTAAACACAGGAAGG + Intergenic
915328338 1:155092783-155092805 CAGTCCAGGCACCCACAGGAGGG + Intergenic
919832184 1:201549684-201549706 CCTGCCCAGCAACCACAGAGAGG + Intergenic
923584590 1:235256399-235256421 TCTTTCAAGGAACCTCAGGAAGG + Intronic
924545510 1:245023008-245023030 CTGCCCAAGCAAGCACAGGAAGG - Intronic
1063961279 10:11307341-11307363 CCTTGCAGGAAATCACAGGAGGG - Intronic
1065800126 10:29344426-29344448 CCTTCCAAAAGGCCACAGGAAGG + Intergenic
1067739228 10:48881965-48881987 CCTTCAGAGAAACCATAGGAAGG - Intronic
1069317844 10:67130129-67130151 CCTTTAAAGAAACCTCAGGAGGG + Intronic
1074751270 10:116589611-116589633 ACTTCCAGGCATCCCCAGGATGG - Intergenic
1075320010 10:121483916-121483938 CCTTCCAAGCAACTAGATTAGGG + Intronic
1075556291 10:123434899-123434921 CATTCCTAGGAACCACAGGTTGG - Intergenic
1078215789 11:9311072-9311094 CTATCCAAGCAACAACAAGATGG + Intronic
1079087618 11:17458093-17458115 CATCCCAGGCAACCACATGATGG + Intronic
1080931428 11:36815572-36815594 CAATCCAACCCACCACAGGAGGG - Intergenic
1081350590 11:42046978-42047000 TCTTCCTAACAACCACATGAAGG - Intergenic
1082798149 11:57393550-57393572 GAATCCAAGAAACCACAGGAAGG - Intronic
1089992359 11:122873523-122873545 TGTTCAAAGCAATCACAGGAAGG - Intergenic
1090447450 11:126776189-126776211 CCCTGAAAGCAGCCACAGGAGGG - Intronic
1094125826 12:27021634-27021656 CCTTCCCCGCAGCCACAGGAAGG + Intergenic
1094837347 12:34328318-34328340 CCTTCCCAGCAGCCACTGCATGG - Intergenic
1095737580 12:45574741-45574763 GTTTCCAAGCAACCCCTGGAGGG + Intergenic
1097299051 12:57998364-57998386 CCCTCCAAACAAGCATAGGAGGG - Intergenic
1100316004 12:93444854-93444876 ACTTCCCAACAACCACATGAAGG - Intergenic
1101817581 12:108157645-108157667 TATTCCAAGCAACCACAGGCTGG + Intronic
1102026597 12:109717333-109717355 CCCTCCAAGCAAGCCCAGAAGGG - Intronic
1102481550 12:113227236-113227258 CCCACCAAGCATCCACAGGCAGG - Intronic
1104127706 12:125863164-125863186 TCTTCCTGGCAACCACAGAAGGG - Intergenic
1105352963 13:19632611-19632633 CCTTCCTAGGACCCACAGGAAGG - Intergenic
1110553923 13:76837134-76837156 CCTTCCAAGCAGCCACATTCTGG + Intergenic
1112010899 13:95293116-95293138 CCATCCAAGCTCCAACAGGAAGG + Intronic
1112179409 13:97062698-97062720 CCTATTAAACAACCACAGGAAGG + Intergenic
1116576319 14:46580762-46580784 ACTTCTAAGAAACCACAGCAGGG - Intergenic
1118201503 14:63678355-63678377 CCTTCCAAGCCCTCACAAGAAGG - Intergenic
1119015152 14:71043522-71043544 CCAACCAACCAACCCCAGGAAGG - Intronic
1120532869 14:85655403-85655425 CCTTCCTAGCACACAAAGGAAGG + Intergenic
1122082295 14:99274314-99274336 CCTTGTAATCAACCCCAGGAAGG - Intergenic
1122357473 14:101132310-101132332 CCTGGCAAGCAGCCACGGGAGGG - Intergenic
1122387610 14:101359708-101359730 CCGTCCGAGCAACCTCAGGAGGG + Intergenic
1123410766 15:20056977-20056999 CCTTCCAAACATCCAGAGGCAGG + Intergenic
1124869404 15:33525991-33526013 CCTTCCAAACAAACTCAGCAAGG + Intronic
1127295771 15:57607573-57607595 GTTCTCAAGCAACCACAGGAGGG - Intronic
1128221056 15:65969025-65969047 TTTGCCAATCAACCACAGGAGGG - Intronic
1128242871 15:66113366-66113388 CATTCCAAGCCACCACTGAAAGG + Intronic
1128643834 15:69360456-69360478 GCTTTCAAGCACCCATAGGAGGG - Intronic
1132546844 16:537146-537168 TCTTCCGAGCACCCACGGGAGGG + Intronic
1133556569 16:6911409-6911431 CGTTGCCAGCAACCACAGGGAGG - Intronic
1135003223 16:18794638-18794660 CCACCCAAGCAACCGCAGCAAGG + Exonic
1135221968 16:20621577-20621599 CCTTCCAAGAGAGCTCAGGAGGG + Intronic
1138292706 16:55861588-55861610 CCCTCCAATCAGCCACAGGCTGG + Intronic
1138563495 16:57816067-57816089 CCATCCACGTACCCACAGGAAGG + Intronic
1139273006 16:65700782-65700804 CCTTCCAAGTAATCAAATGAGGG + Intergenic
1141317088 16:82972580-82972602 CCGTCCCAGCTACCATAGGATGG - Intronic
1142263152 16:89051802-89051824 CCTTCCCAGCAATTACAGGCTGG - Intergenic
1142579480 17:932551-932573 CCTTCTAAGAAAACACAGGCTGG + Intronic
1150594011 17:66588191-66588213 CCTTCCCAGCAATCACAGAGAGG - Intronic
1151477259 17:74351109-74351131 TCTTCCCAGCAACCCCATGAGGG - Intronic
1154035269 18:10795154-10795176 CCTTCCAAGCCACCACTCCACGG - Intronic
1157731574 18:50008698-50008720 CTTGCCAAGCCACCACAGAAAGG + Intronic
1159065754 18:63566593-63566615 CCTTTCAAGCTACAAGAGGAAGG - Exonic
1160080019 18:75717499-75717521 CACTCCAAACATCCACAGGATGG + Intergenic
1161039268 19:2101387-2101409 CCTTCCCAGCACCCTTAGGAAGG - Exonic
1161766338 19:6211009-6211031 CCTTCCACTCAGCCAGAGGAGGG - Intergenic
1162795498 19:13085375-13085397 CCTTCCAAGCAACCACAGGACGG - Intronic
1165347629 19:35258851-35258873 CCTTCCCAGCACACCCAGGAGGG - Intronic
1167006729 19:46781091-46781113 TCTTCCCAGCAACCCCCGGAGGG + Intronic
1167222682 19:48212896-48212918 CCTTCCAGGCAACAACAGCTAGG + Intronic
1167718961 19:51164600-51164622 CCTACCAAGGAACATCAGGAGGG + Intergenic
926495966 2:13588780-13588802 CCTTCCAAAGAAACACAGTATGG - Intergenic
927360717 2:22229775-22229797 GTTTCCAGGAAACCACAGGATGG + Intergenic
931916298 2:66960523-66960545 CCTTCCACTCACCCACAGGAAGG + Intergenic
932729704 2:74210110-74210132 ACTTCCAAACATGCACAGGATGG - Intronic
936518700 2:113198653-113198675 CTGTGCAAGCAGCCACAGGAGGG + Intronic
941020616 2:160404930-160404952 CCTTCCAAGCCACCACACTACGG - Intronic
941256873 2:163242940-163242962 CATTCCCAACAACAACAGGATGG - Intergenic
943687993 2:190839459-190839481 TTTTGCAATCAACCACAGGAAGG + Intergenic
948383770 2:237568763-237568785 CCTTCCAAGTAGCCAAAGGGTGG + Intergenic
1170304105 20:14918413-14918435 CCATCCAGGCAACCGGAGGAGGG + Intronic
1171134295 20:22683245-22683267 CCTTTCAAGGAACCCCTGGAAGG + Intergenic
1172052957 20:32133202-32133224 TCTTCTCTGCAACCACAGGATGG - Intronic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1172881566 20:38203182-38203204 CCCTTCTAGCAGCCACAGGAAGG - Intergenic
1176671309 21:9737579-9737601 GCTTACAAGCATCCACATGAGGG + Intergenic
1178253040 21:31022995-31023017 CTTACAAAGCAACCACGGGAAGG + Intergenic
1179961383 21:44768699-44768721 GCTTCTAAGCAACTGCAGGAGGG + Exonic
1183099677 22:35576108-35576130 TCCTCCAAGCAACCCTAGGAAGG + Intergenic
1184451752 22:44586563-44586585 CCTTCCAAACGAACACAGCAAGG + Intergenic
1185119693 22:48958581-48958603 CCTGCCCAGCAGCCAGAGGAGGG - Intergenic
954462792 3:50637217-50637239 GCTTCCGAGCAAACAAAGGATGG - Intronic
955319180 3:57961985-57962007 CCTTGGAAGAAACCACTGGAAGG - Intergenic
958655180 3:96992170-96992192 TCTTCCAAGCTATCACAGGCAGG + Intronic
963286259 3:143437306-143437328 GCTTGCAAGCAAACAGAGGAAGG - Intronic
965475457 3:169149612-169149634 CCTTCCGAGCTACGAGAGGAAGG + Intronic
966742036 3:183242838-183242860 CCATCAAAGCAACCACAAGGGGG + Intronic
966792228 3:183683893-183683915 TCTGCCAAGCAACCACACGTTGG - Exonic
969637269 4:8376659-8376681 CCTTCCTGGCACCGACAGGACGG - Intronic
970235018 4:13949975-13949997 CCTTGCATGGTACCACAGGATGG - Intergenic
971252282 4:24983371-24983393 CTTTCCAAGCAGCAAAAGGAGGG - Intergenic
975715745 4:77204122-77204144 CCTTCCATCCAAGCACAAGAAGG - Intronic
977097120 4:92760344-92760366 TCTTCCCAGCAGCCAGAGGAAGG - Intronic
977709109 4:100104458-100104480 CCTTCTAAGCAACCAAAAGCAGG + Intergenic
978328943 4:107590324-107590346 CCGTCCCAGCAGCCACAGGTGGG - Intronic
986293296 5:6417500-6417522 CCTTCCCAGGGACCACAGGAAGG + Intergenic
986415476 5:7523872-7523894 CCTTCTAAGCCACCAAAGGAAGG + Intronic
988900410 5:35726006-35726028 CCATCCATGCAACCATATGAAGG - Intronic
989866825 5:46522951-46522973 CCTTCAAAGAAACAACCGGACGG + Intergenic
989866985 5:46525687-46525709 CCTTCAAAGAAACAACCGGACGG + Intergenic
990689581 5:58348526-58348548 GCTTCCAGGCAACAACAGTAGGG - Intergenic
993246981 5:85463937-85463959 CCTTCCAAGAAATCAGAAGAAGG + Intergenic
993525207 5:88956641-88956663 CTTTCCATGGAGCCACAGGATGG - Intergenic
993902400 5:93593539-93593561 CTGCCCAAGCAGCCACAGGAGGG - Intronic
1000403429 5:160858671-160858693 CTGTTCAAACAACCACAGGAAGG - Intergenic
1000940364 5:167353440-167353462 CCGTCCAAGTGACCACATGATGG + Intronic
1002931203 6:1636567-1636589 CCTTCCAGGCACCTTCAGGACGG - Intronic
1004348835 6:14873316-14873338 GCTTCCAAACAGACACAGGAAGG - Intergenic
1006812734 6:36830511-36830533 CCTGCCAAGCAACCTCACCAAGG + Intronic
1014104380 6:117546532-117546554 ACTTCCAAGGAACAAGAGGATGG - Intronic
1015185333 6:130409107-130409129 CCTTGGAAGCAACGAAAGGAAGG - Intronic
1016396051 6:143624634-143624656 CCATCCAAGCAGACACAGGCTGG - Intronic
1017026975 6:150189939-150189961 CCCTCCAGGCATCTACAGGAGGG + Intronic
1021728565 7:23574356-23574378 CCTGCTAAGCTACCAAAGGAGGG - Intergenic
1021946329 7:25731413-25731435 CCTTCCTGGAAACCACAGCAAGG + Intergenic
1022216143 7:28263597-28263619 GTTCCCAAGAAACCACAGGAAGG - Intergenic
1023263331 7:38379948-38379970 CACTTCCAGCAACCACAGGAAGG + Intergenic
1023685757 7:42733417-42733439 CCTTCCTAGCGGCCACAGCATGG + Intergenic
1025091014 7:56064396-56064418 CCTTCCCAGCGCCCCCAGGATGG - Intronic
1025762118 7:64404878-64404900 CCTACCAAGCACCCTCGGGAGGG - Intergenic
1026274003 7:68861005-68861027 CCTTCCAAACGACCCCAGTAAGG - Intergenic
1026340530 7:69430416-69430438 CCTCCCCAGCAAACCCAGGAAGG - Intergenic
1030296528 7:107934441-107934463 CCTTCCTTGAAAACACAGGAAGG + Intronic
1031352309 7:120749456-120749478 CATTCCAAGCCACCACTGTAAGG + Exonic
1033785307 7:144722877-144722899 CCTTCCTAACCACAACAGGAGGG + Intronic
1034605369 7:152307769-152307791 CCTTCCTAGCAAACAGAGGTAGG + Intronic
1036699489 8:11002583-11002605 CCCTCCCAGCCAGCACAGGAAGG + Intronic
1037914024 8:22761129-22761151 CCTCCCCAGCAAGCACAGGTGGG + Intronic
1038078277 8:24102480-24102502 GCTTACAAGAAATCACAGGAAGG - Intergenic
1038363446 8:26906714-26906736 TCTTCCAAACAATCACAGGAGGG - Intergenic
1040806241 8:51399548-51399570 CCTTCCCAGCAACCACATATTGG - Intronic
1042754560 8:72196423-72196445 CCTTCCACTCACCCACAGCAAGG - Intergenic
1044776544 8:95694824-95694846 ACTTCCAAGCTAACACAGTAAGG + Intergenic
1046623102 8:116548457-116548479 CCCTCCCAACAACCACATGAGGG + Intergenic
1048016269 8:130500265-130500287 CCCTCGAAGCAGCCAGAGGATGG - Intergenic
1049094790 8:140542068-140542090 CCATGCAAGCAGCCACCGGAAGG + Intronic
1049736764 8:144211823-144211845 CCTTCCAAACCACCTCTGGAGGG - Intronic
1049867616 8:144949163-144949185 CATAGCAAGCAGCCACAGGATGG + Intronic
1051042544 9:12829869-12829891 CATTCCAAGCTACCAAATGATGG - Intergenic
1051061626 9:13052418-13052440 ATTTCCAAGCAATCACAGAAAGG + Intergenic
1051502894 9:17797310-17797332 CCTTCCTGGTAACCCCAGGAAGG + Intergenic
1054380563 9:64485980-64486002 CCTGCCAAGGAACCAAAGCAAGG + Intergenic
1054515183 9:66030331-66030353 CCTGCCAAGGAACCAAAGCAAGG - Intergenic
1055078852 9:72246749-72246771 CCCTCAAATCAAACACAGGAAGG - Intronic
1057506464 9:95637767-95637789 CTTTCCCAGCAGCCACAGAAGGG - Intergenic
1058635154 9:107031438-107031460 CCTCCCAAGCAACCACTGCTAGG + Intergenic
1060714389 9:125909379-125909401 CATTCCTTGCTACCACAGGAAGG - Intronic
1185610482 X:1391538-1391560 CCTGCCAGGCATCCACCGGAAGG + Intronic
1190060443 X:47207938-47207960 TCTTCCTAGCAACCCCATGAAGG + Intronic
1196458062 X:115903684-115903706 CTCCCCAAGCAACCACAGGAAGG + Intergenic
1198017994 X:132631227-132631249 CCTTGCAAAAAATCACAGGAAGG + Intronic
1199374706 X:147094015-147094037 CTTTCCAAGCAAACAAAAGAAGG + Intergenic