ID: 1162796319

View in Genome Browser
Species Human (GRCh38)
Location 19:13089388-13089410
Sequence TTCCTCTCAGGTTGTCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162796319_1162796323 8 Left 1162796319 19:13089388-13089410 CCATCTGGACAACCTGAGAGGAA No data
Right 1162796323 19:13089419-13089441 TGTTGAGATCATTTTGTCTTTGG No data
1162796319_1162796324 9 Left 1162796319 19:13089388-13089410 CCATCTGGACAACCTGAGAGGAA No data
Right 1162796324 19:13089420-13089442 GTTGAGATCATTTTGTCTTTGGG No data
1162796319_1162796325 16 Left 1162796319 19:13089388-13089410 CCATCTGGACAACCTGAGAGGAA No data
Right 1162796325 19:13089427-13089449 TCATTTTGTCTTTGGGCCCCAGG No data
1162796319_1162796326 20 Left 1162796319 19:13089388-13089410 CCATCTGGACAACCTGAGAGGAA No data
Right 1162796326 19:13089431-13089453 TTTGTCTTTGGGCCCCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162796319 Original CRISPR TTCCTCTCAGGTTGTCCAGA TGG (reversed) Intronic