ID: 1162796597

View in Genome Browser
Species Human (GRCh38)
Location 19:13090473-13090495
Sequence CTGGAGTCCTTGGGGCTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162796584_1162796597 25 Left 1162796584 19:13090425-13090447 CCAGGGGAGTAGTCAGGGTTGGG 0: 1
1: 0
2: 0
3: 17
4: 237
Right 1162796597 19:13090473-13090495 CTGGAGTCCTTGGGGCTAACAGG 0: 1
1: 0
2: 1
3: 15
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162796597 Original CRISPR CTGGAGTCCTTGGGGCTAAC AGG Intronic
900082543 1:869611-869633 CCGGAGTCCGGGGGGCTAATGGG + Intergenic
900852739 1:5156882-5156904 GTGGAGTGGTTGGGGCTGACTGG + Intergenic
904221447 1:28973301-28973323 CTGGTGTCCTTGGGGATATTGGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
909019020 1:70411060-70411082 CTGGAGTCCCTGGGTCCAAGTGG - Intergenic
912100875 1:106202519-106202541 CTGGAGTCCCAGAGGCTAACTGG + Intergenic
912272808 1:108228043-108228065 CTGGAGCCCCTGGGGCTGCCTGG - Intronic
912295412 1:108466279-108466301 CTGGAGCCCCTGGGGCTGCCTGG + Intronic
913599128 1:120405974-120405996 CTGGAGCCCCTGGGGCTGCCTGG + Intergenic
914088250 1:144473646-144473668 CTGGAGCCCCTGGGGCTGCCTGG - Intergenic
914310361 1:146460564-146460586 CTGGAGCCCCTGGGGCTGCCTGG + Intergenic
914314823 1:146500190-146500212 CTGGAGCCCCTGGGGCTGCCAGG - Intergenic
914499528 1:148233198-148233220 CTGGAGCCCCTGGGGCTGCCAGG + Intergenic
914591748 1:149112578-149112600 CTGGAGCCCCTGGGGCTGCCTGG - Intergenic
920979337 1:210818113-210818135 CAGGACTCCTTGGGGCTCAAAGG + Intronic
922813113 1:228429140-228429162 CAGGTGTCCTTAGGGCTAACGGG + Intergenic
922863364 1:228838101-228838123 CTGGAGTCTTTGGGCCTGGCAGG - Intergenic
924386730 1:243506167-243506189 CTGCGGTCCTTGGGCCTGACGGG - Intronic
1063972215 10:11389110-11389132 CTGCAGTCCTTGGGGCTCTTGGG + Intergenic
1064323459 10:14327701-14327723 ATGGAGTCATCGGGGCTAAGGGG - Intronic
1067078495 10:43201307-43201329 CTGGAGTACTCGGGGTGAACAGG + Intronic
1068591268 10:58855427-58855449 CTGTAATCCCTGGGGCTTACAGG + Intergenic
1068718160 10:60211231-60211253 CTGGTGTCCTTCAGGCTAGCAGG - Intronic
1069627540 10:69877411-69877433 CTGGAGTCCTTGGACCTGGCCGG - Intronic
1069952969 10:72032322-72032344 CTGGAGTCCTGGGGCCTGAGAGG - Intergenic
1072489729 10:95892755-95892777 CTGGACTGCTTAGGGCAAACCGG - Intronic
1072616101 10:97049670-97049692 CTGGAGTCCCTGGGCTTCACAGG + Intronic
1077484869 11:2833997-2834019 CTGCACTCCTTGTGGCTAAGTGG - Intronic
1080692546 11:34570517-34570539 CTGGAGTCCCTGGGTCCAGCTGG - Intergenic
1081230145 11:40576228-40576250 CTGGTGTCCCTGGGGCTTGCTGG - Intronic
1082266906 11:50129049-50129071 CTGGAGACCTTGAGGCCAAATGG - Intergenic
1082289183 11:50349519-50349541 CTGGAGACCTTGAGGCCAAATGG + Intergenic
1084391574 11:68880693-68880715 CTGGAGTCCTTTGGTCTTTCTGG + Intergenic
1085256417 11:75176107-75176129 CAGGAGTCCATGGGCCTAGCAGG - Intronic
1090413406 11:126524384-126524406 CTGGACCCTTTGGGGTTAACAGG + Intronic
1095992942 12:48050514-48050536 CCTGAGTCCTTTGGGCTGACTGG - Intronic
1097160517 12:57043449-57043471 CTGGTGTCCTGGGGTCTCACTGG + Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1107386287 13:39913422-39913444 CTAGAATCTTTGGGGCTACCTGG + Intergenic
1110639664 13:77807980-77808002 CTGAAGTTCCTGGGGCTATCTGG + Intergenic
1111584858 13:90270558-90270580 CTGTAGTCCTTAGAGCTAAATGG + Intergenic
1114740937 14:25096416-25096438 CTGAAGTCCATGGGCCTAACAGG - Intergenic
1116252608 14:42506111-42506133 CTGGAGTCCTTGGTGGAAAATGG - Intergenic
1117380462 14:55157052-55157074 CTGGAGTCTTTTGGACTTACTGG - Intronic
1121300439 14:92866441-92866463 CTGGAGTTGATGGGGGTAACTGG + Intergenic
1122344121 14:101047583-101047605 CGGGACTCCTTGGTGCTATCAGG + Intergenic
1129517143 15:76163660-76163682 CAGGAGTCCTTGGGGCCTCCTGG + Intronic
1129681807 15:77662375-77662397 CTGGAGCCCTTGGGGATGAGGGG + Intronic
1130839789 15:87687486-87687508 CTGGATTCCTGGGTGCTAACTGG + Intergenic
1131237087 15:90706091-90706113 CTGGAGTAGCTGGGACTAACAGG + Intergenic
1131293921 15:91130710-91130732 CTGCAGTCCTGGGGGCAAAGAGG + Intronic
1131439449 15:92447955-92447977 CTGGAGTCCTTGGGGATAAGAGG + Intronic
1133879693 16:9769053-9769075 CTGGAGACCCTGTGGCTCACTGG - Exonic
1135171421 16:20187283-20187305 CTGGAGTTCTTAGGGCTGAGAGG - Intergenic
1135723919 16:24839938-24839960 TTGGAGTCCTTGGTGTTAAGAGG - Intergenic
1136084708 16:27876687-27876709 CTGGAGGCCTGGGGGCCAAGGGG - Intronic
1137761828 16:50947294-50947316 CTGGAGCCCTTAGGGCTCTCTGG - Intergenic
1144726459 17:17504895-17504917 CTGGAGTCCTGGGGGCTGAGGGG + Intergenic
1144882874 17:18439620-18439642 CTGGAGCCCTTGGGGCCAGTGGG - Intergenic
1145149357 17:20504766-20504788 CTGGAGCCCTTGGGGCCAGTGGG + Intergenic
1146307477 17:31741700-31741722 CTGGAATATTTGGGGATAACTGG - Intergenic
1148107493 17:45127234-45127256 CTGGAGGCCATGGGACTAAGGGG - Intronic
1149610963 17:57957418-57957440 CTGGAGCCCTGGGGGCTCAGAGG - Intergenic
1151153976 17:72111517-72111539 CTGCAGTCCCTGGGGCCATCTGG + Intergenic
1151499611 17:74480485-74480507 CTGGCGTCCCTGGGGCTGACAGG + Intronic
1152114535 17:78377458-78377480 CTGCAGCCTCTGGGGCTAACAGG + Intergenic
1155680750 18:28482845-28482867 CTGGTGTTCTTGGGTCTTACAGG - Intergenic
1157493922 18:48142215-48142237 ATGGAGTCCTTTGGGCTTACTGG + Intronic
1162796597 19:13090473-13090495 CTGGAGTCCTTGGGGCTAACAGG + Intronic
1164322079 19:24157931-24157953 CTGGAGTCCTATGGATTAACAGG + Intergenic
1165988345 19:39790290-39790312 CTGGGGTCATTGGGGGTAAAGGG + Intergenic
1166357169 19:42234020-42234042 CTGGAGACCTTGGGGGAACCGGG - Intronic
1167696804 19:51019732-51019754 CCGGACTCCTTGGGGTTAAAAGG - Intronic
1168264364 19:55213917-55213939 CTGGTGTGCTTGGGGCTGTCAGG + Intergenic
933614278 2:84468399-84468421 CTGGACTCCTTGGGGTAAACAGG - Intergenic
936153488 2:110033987-110034009 CTGGGGTCCTTGGTGCCAGCAGG + Intergenic
936191193 2:110337428-110337450 CTGGGGTCCTTGGTGCCAGCAGG - Intergenic
939106026 2:137949836-137949858 CTGGAGGACTTGGGGCTGGCAGG + Intergenic
940168262 2:150799156-150799178 CTGGAATCCTTGGGACTGTCAGG - Intergenic
1169425415 20:5493041-5493063 CTGAAGTCCTTGAGGATACCTGG - Intergenic
1170894836 20:20403649-20403671 CTGGAGGCTGTGGTGCTAACTGG + Intronic
1172010440 20:31843124-31843146 CTGGAGTCCTCGGGGCTGCCTGG + Intergenic
1180137652 21:45871618-45871640 CTGCAGTCCCTGAGCCTAACCGG + Intronic
1181808695 22:25390720-25390742 CTGGAGCCCTTGTGGCACACAGG - Intronic
1184978540 22:48080325-48080347 CTGGAGTTCTGGGGTCCAACTGG - Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950364723 3:12474896-12474918 CTGGAGGCCTGGGGGCTGAGAGG - Intergenic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951109654 3:18786793-18786815 CTGGAGTCTTTGGGGTAAAGGGG - Intergenic
952567744 3:34679647-34679669 CTGGGGTCCTTGGTGCCACCAGG + Intergenic
953760349 3:45682068-45682090 GTGTAGTCCTTGTGGCTACCAGG + Exonic
954622111 3:52002266-52002288 ATGGAGTCCTTGGGCATGACTGG + Intergenic
955060944 3:55490905-55490927 CTGAAGTCCTTGGGACTAGACGG - Intergenic
956781647 3:72607826-72607848 CGGAAGTCCTTGGGGCTCCCTGG - Intergenic
959527045 3:107388933-107388955 GTGGTTTCCTTGGGGCTCACAGG - Intergenic
959594594 3:108115290-108115312 CAGGTTTCCTTGGGGCTGACAGG + Intergenic
959691096 3:109199111-109199133 TTGGTGTCATTTGGGCTAACAGG + Intergenic
961109475 3:124271709-124271731 CAGGAGACCTAGGGGCTAACAGG - Intronic
962755002 3:138460032-138460054 CCGCAGTCCTTGGGACTCACCGG - Exonic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
966327275 3:178771303-178771325 ATGGAGTCCTTCTGGCTGACAGG - Intronic
968450834 4:675232-675254 CTGGTGTCCATGGGGCTGGCGGG - Intronic
968661074 4:1799045-1799067 CCGGAGTCCTTGGGACAGACTGG + Intronic
969281300 4:6172472-6172494 CTGGGGTTCTCGGGGGTAACTGG - Intronic
970485571 4:16521311-16521333 CTGCAATCCTTGGGGCTCATTGG + Intronic
972058857 4:34840608-34840630 CTGGAGTAGCTGGGACTAACAGG + Intergenic
972115548 4:35628822-35628844 CTGGAGACCATGAGGCTACCTGG + Intergenic
990007839 5:50963970-50963992 GTGGAGTCCCTGGGGCGAACTGG - Intergenic
993307748 5:86291918-86291940 CTGGAGCCCCTGGGGCTGCCTGG + Intergenic
995258302 5:110072718-110072740 CTGGACTCCCTGGAGCTAGCAGG + Intergenic
999393425 5:151211314-151211336 CAGGAGCCCTTTGGGCTAGCAGG - Intronic
1003146273 6:3513012-3513034 CTGGTGGCCTGGGGGATAACTGG + Intergenic
1006077973 6:31546533-31546555 CTGGATACCTTGGGACTGACTGG + Exonic
1007253467 6:40512212-40512234 CTGGAGGCCTTGGGTCTTTCAGG - Intronic
1010242759 6:73631786-73631808 CTGGAGACCTTGGGCCCCACAGG + Intronic
1011983499 6:93416764-93416786 CCGGAGTCCTGTGGGCCAACAGG + Intronic
1014698605 6:124655548-124655570 CTGGTGTGCTTGGGACTAAGGGG + Intronic
1015811148 6:137163450-137163472 CTGGGGTCCTTGGTGCCACCGGG + Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1021545844 7:21812249-21812271 CTGGAGTCCATGGGTCTTAAAGG + Intronic
1022326008 7:29332562-29332584 CTGGAGACCGTGTGGCTGACGGG - Intronic
1022677848 7:32516508-32516530 CTGGATTACTAGGGGCTAAGTGG + Intronic
1023022006 7:36019129-36019151 CAGGAGTCCTTGGGGCTTAGGGG + Intergenic
1024675479 7:51634391-51634413 CTGGAGTCCTCTTGGCTAAGAGG + Intergenic
1024733028 7:52273978-52274000 GTGGAGTCCTTGCGTCTAGCGGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1032121541 7:129160492-129160514 CTGGAGGCCTGGGGGCTAGGGGG + Intronic
1036644907 8:10607011-10607033 CTGGAGTCCTTGAGCCCAAAGGG + Exonic
1045543827 8:103110827-103110849 CTGGTGGCCCTGGGGGTAACAGG + Intergenic
1046495117 8:115004076-115004098 CTGGAGGGCTTGGAGCTAACAGG - Intergenic
1046596001 8:116261995-116262017 CTGGAGTATTTGGGGCCAAATGG - Intergenic
1048053476 8:130841692-130841714 CTGGACTCCCTGGAGCTATCTGG + Intronic
1048233148 8:132663656-132663678 CTGGAGTCCATGGGGCCAGGAGG + Intronic
1049154728 8:141059641-141059663 CAGGAGTCCTTGAGCCTAAGTGG + Intergenic
1049453668 8:142676190-142676212 CTGGAGTCCCTGGAGGCAACTGG + Intronic
1049585971 8:143432519-143432541 CTGGAGGCCCTGGGGCACACTGG + Intergenic
1049629213 8:143643244-143643266 CTGGAGGCCCTGGGGAAAACTGG - Intronic
1050027581 9:1351719-1351741 CTAGAGTTCTTGGAGCTCACAGG + Intergenic
1050800549 9:9607248-9607270 CTGGAGTCTATGGGGATTACTGG + Intronic
1051026790 9:12622928-12622950 CTGGATTCTTTGGGGCTATATGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1053126619 9:35586033-35586055 CTGGTGTTCTTGGGTCTTACGGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1062132751 9:134908758-134908780 CTGGAGTCCCTGGGCCTTACTGG - Intronic
1203564239 Un_KI270744v1:78962-78984 CTGGGGTCCTTCGGGATAAGTGG - Intergenic
1190161313 X:48033408-48033430 CTGTAATCCTTAGGGCTTACTGG - Intronic
1192227524 X:69239303-69239325 CTTGAGTCCTTGGATCTCACTGG + Intergenic
1192571172 X:72206758-72206780 CTGCAGTCTTTGGGGATAGCTGG - Exonic
1192829417 X:74735648-74735670 CTGAAGTCCTTGGTGCTAGCTGG - Exonic
1194585685 X:95731115-95731137 CTGGAGTCCTTGAGGTAAGCAGG + Intergenic
1195525320 X:105882299-105882321 CTGAAGACCTTGAGGCTAAGTGG - Intronic
1195853598 X:109308148-109308170 CTGGAGTTTTTGGGCCTAAGAGG + Intergenic