ID: 1162797036

View in Genome Browser
Species Human (GRCh38)
Location 19:13092388-13092410
Sequence AGGGACAAAGGCTGCCCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162797036_1162797046 18 Left 1162797036 19:13092388-13092410 CCCTTGGGGCAGCCTTTGTCCCT No data
Right 1162797046 19:13092429-13092451 AGAGTCTTCCTTCCCTGAGGAGG No data
1162797036_1162797044 15 Left 1162797036 19:13092388-13092410 CCCTTGGGGCAGCCTTTGTCCCT No data
Right 1162797044 19:13092426-13092448 ACCAGAGTCTTCCTTCCCTGAGG No data
1162797036_1162797039 -9 Left 1162797036 19:13092388-13092410 CCCTTGGGGCAGCCTTTGTCCCT No data
Right 1162797039 19:13092402-13092424 TTTGTCCCTAACTCCAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162797036 Original CRISPR AGGGACAAAGGCTGCCCCAA GGG (reversed) Intronic