ID: 1162797315

View in Genome Browser
Species Human (GRCh38)
Location 19:13093720-13093742
Sequence AGGTCCCAAGATGCATTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 131}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162797312_1162797315 1 Left 1162797312 19:13093696-13093718 CCAGAGTCTGTGACAGCCTGGGA 0: 1
1: 0
2: 2
3: 19
4: 217
Right 1162797315 19:13093720-13093742 AGGTCCCAAGATGCATTTTCAGG 0: 1
1: 0
2: 1
3: 11
4: 131
1162797309_1162797315 9 Left 1162797309 19:13093688-13093710 CCTGCAGACCAGAGTCTGTGACA 0: 1
1: 0
2: 1
3: 24
4: 158
Right 1162797315 19:13093720-13093742 AGGTCCCAAGATGCATTTTCAGG 0: 1
1: 0
2: 1
3: 11
4: 131
1162797305_1162797315 19 Left 1162797305 19:13093678-13093700 CCGCCTGGCCCCTGCAGACCAGA 0: 1
1: 0
2: 2
3: 41
4: 363
Right 1162797315 19:13093720-13093742 AGGTCCCAAGATGCATTTTCAGG 0: 1
1: 0
2: 1
3: 11
4: 131
1162797306_1162797315 16 Left 1162797306 19:13093681-13093703 CCTGGCCCCTGCAGACCAGAGTC 0: 1
1: 0
2: 6
3: 19
4: 314
Right 1162797315 19:13093720-13093742 AGGTCCCAAGATGCATTTTCAGG 0: 1
1: 0
2: 1
3: 11
4: 131
1162797308_1162797315 10 Left 1162797308 19:13093687-13093709 CCCTGCAGACCAGAGTCTGTGAC 0: 1
1: 0
2: 0
3: 11
4: 179
Right 1162797315 19:13093720-13093742 AGGTCCCAAGATGCATTTTCAGG 0: 1
1: 0
2: 1
3: 11
4: 131
1162797307_1162797315 11 Left 1162797307 19:13093686-13093708 CCCCTGCAGACCAGAGTCTGTGA 0: 1
1: 1
2: 2
3: 19
4: 512
Right 1162797315 19:13093720-13093742 AGGTCCCAAGATGCATTTTCAGG 0: 1
1: 0
2: 1
3: 11
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162797315 Original CRISPR AGGTCCCAAGATGCATTTTC AGG Intronic
900929671 1:5728615-5728637 AATTCCCAAGCTTCATTTTCAGG - Intergenic
904801301 1:33094638-33094660 GGGTCACAAGATGCACGTTCTGG + Exonic
907269587 1:53283061-53283083 AAGTTCCAACATGGATTTTCAGG - Intronic
907512741 1:54973794-54973816 TGGTGCCAAGATGATTTTTCAGG - Intergenic
917331044 1:173880755-173880777 AGGACCCAATCTGCATTTTGTGG + Intronic
921429806 1:215052424-215052446 AGGTCACATGATGGATTTTGTGG + Intronic
922174641 1:223187830-223187852 ATGTCCCAGGGTGCAATTTCTGG - Intergenic
923954924 1:239005466-239005488 TGCTCCCACGATGCATTTTGAGG + Intergenic
924041537 1:239988882-239988904 AGATACCTACATGCATTTTCTGG + Intergenic
1065005073 10:21372007-21372029 AGTTACAAAAATGCATTTTCTGG - Intergenic
1066665798 10:37781411-37781433 ATGTAGCAAGATGCATTTTAAGG + Intronic
1068076783 10:52265679-52265701 AGCTCTGAAGATGCATTTGCTGG - Intronic
1069404852 10:68088004-68088026 ACCTCCCAAGATGAATTTTGAGG - Intergenic
1070416356 10:76193478-76193500 GGATCCCCAGATGAATTTTCTGG - Intronic
1070648241 10:78216201-78216223 AGGTCCTTAGATGCCTTGTCTGG - Intergenic
1072765693 10:98093574-98093596 AGATCCCAAGATTCATCCTCCGG - Intergenic
1074562063 10:114543718-114543740 GGGTCCCAAGAGTCATATTCTGG - Intronic
1076886725 10:133266522-133266544 AGGTCCCACGGTGCATCTCCGGG - Intronic
1076980965 11:204541-204563 AGCACCAAAGATGTATTTTCAGG - Exonic
1078781238 11:14441288-14441310 AGGCCCCCAGCAGCATTTTCTGG + Intergenic
1078966311 11:16348231-16348253 AGGTGCCAAGCTGCATTGCCAGG + Intronic
1079688538 11:23393499-23393521 AAGCCCCAAGATGCAGTTACTGG + Intergenic
1079705339 11:23609358-23609380 TGGTGCCAATTTGCATTTTCTGG - Intergenic
1080684617 11:34504814-34504836 AGGTCCCATGCTGCCTTCTCAGG + Intronic
1081315785 11:41627784-41627806 ATGTTTTAAGATGCATTTTCCGG - Intergenic
1081698889 11:45139629-45139651 AGTTCCCAAAATGAAATTTCAGG - Intronic
1083366819 11:62146461-62146483 CTGTCACAAGATGCCTTTTCAGG + Intronic
1088205184 11:107384177-107384199 AAGGCCCAAGATCCATTTTCAGG + Intronic
1090298647 11:125613924-125613946 AGGTGCCAGGATTTATTTTCTGG + Intronic
1090422660 11:126586191-126586213 AGGTCCTCAGGTGCCTTTTCTGG - Intronic
1092055936 12:5508003-5508025 AGGTCCCAAAATGCAAATGCAGG + Intronic
1094747871 12:33367254-33367276 ATGTTCAGAGATGCATTTTCTGG + Intergenic
1097159431 12:57035908-57035930 ACCTCCCAAGATCCATTTTAGGG - Intronic
1102261601 12:111446539-111446561 AGATCCCAAGAAGCATGTGCTGG - Intronic
1108397703 13:50006281-50006303 AGGGGCCAAGAAGAATTTTCAGG - Intronic
1110753861 13:79147832-79147854 AGGTGCCAAGATGCAGTATTTGG - Intergenic
1111628935 13:90825512-90825534 AGGTCCCAGGTTGCTATTTCTGG + Intergenic
1111915129 13:94352487-94352509 AGGCCCCAACATTCATTCTCGGG + Intronic
1113528664 13:111003201-111003223 GGGTTCCAAGATTTATTTTCTGG + Intergenic
1115925588 14:38429765-38429787 TGGTCCTAAGATTAATTTTCTGG - Intergenic
1120948274 14:90018395-90018417 AGGTGCCAAGGTGCATATTAAGG - Intronic
1123938535 15:25205609-25205631 GGGCCCCAGGATGCAATTTCCGG + Intergenic
1124485666 15:30113145-30113167 AAGTCTCAAGATGCAGTATCTGG + Intergenic
1124517909 15:30384122-30384144 AAGTCTCAAGATGCAGTATCTGG - Intronic
1124540744 15:30582131-30582153 AAGTCTCAAGATGCAGTATCTGG + Intergenic
1124547428 15:30643879-30643901 AAGTCTCAAGATGCAGTATCTGG + Intronic
1124757913 15:32425451-32425473 AAGTCTCAAGATGCAGTATCTGG - Intergenic
1127913604 15:63437759-63437781 GAGTCCCCAAATGCATTTTCAGG - Intergenic
1128735320 15:70050390-70050412 AGCACCCATGAAGCATTTTCAGG + Intronic
1130972690 15:88746436-88746458 GGGTCTCAAGATTTATTTTCTGG - Intergenic
1132295017 15:100728520-100728542 AGGTCACATGATGCATTTGATGG - Intergenic
1133591159 16:7245337-7245359 AGGTTCCAAGATACATGTACAGG + Intronic
1133867372 16:9656873-9656895 AGCTCCCAGAATGCATCTTCTGG + Intergenic
1138578702 16:57925643-57925665 AGGTCCCAGGACCTATTTTCTGG - Intronic
1140052317 16:71493008-71493030 AGGTTTTAAAATGCATTTTCAGG - Intronic
1143897030 17:10144392-10144414 AGGCCCCAAGAGGCATTTTTGGG + Intronic
1145449418 17:23223983-23224005 AGGTCCAAATATGCACTTGCAGG - Intergenic
1146657256 17:34641928-34641950 AGGTCCCTCGATTCGTTTTCGGG - Intergenic
1159505633 18:69331827-69331849 AGGTCCCAAAATTCCTTTTCTGG - Intergenic
1160191456 18:76717502-76717524 AGTTTCCAACATGCATTTTGGGG + Intergenic
1160376429 18:78416562-78416584 ACTTCCCAAAATGCATTTTAAGG - Intergenic
1162797315 19:13093720-13093742 AGGTCCCAAGATGCATTTTCAGG + Intronic
1163198616 19:15745446-15745468 AAGTTCCAGGATGCATGTTCCGG + Intergenic
1168011840 19:53539130-53539152 AGGCCCCGAGATGGAGTTTCTGG - Intronic
1168013873 19:53555759-53555781 AGGCCCCGAGATGGAGTTTCTGG - Intronic
1168476831 19:56682139-56682161 AGGTCCCAAAATGTAGTTTAAGG + Intergenic
925018101 2:546980-547002 ATGTCCCAAAAAGCATTTTCTGG + Intergenic
925754009 2:7116538-7116560 TGTTCCCCAGCTGCATTTTCAGG + Intergenic
926396226 2:12445566-12445588 TGGTCACAAGATGCATCTTCCGG + Intergenic
927138822 2:20115896-20115918 AGGTCCCCAGAAGCCTTCTCTGG - Intergenic
931571000 2:63669119-63669141 ATGTCCCAAGATCCATACTCAGG + Intronic
932781346 2:74560537-74560559 TGGCCCCAAGATGCATGTCCAGG + Intronic
933453462 2:82490147-82490169 ATGTTCCAAGATACATTTGCAGG + Intergenic
935841377 2:107115004-107115026 AGCTCCCAAAATGCATTTTTTGG - Intergenic
938324002 2:130385339-130385361 GGGTCCCTAGATGAATTATCAGG + Intergenic
941277190 2:163504025-163504047 AAGTCCCAAGATGCATGTGCAGG - Intergenic
941461001 2:165771851-165771873 AGGTTCTAAGATGGATTCTCTGG + Intronic
941847244 2:170145387-170145409 AGGACTCAAGGTGCAATTTCTGG + Intergenic
1168933669 20:1645140-1645162 AGGACCCAAGATAGAGTTTCCGG - Intronic
1172149518 20:32780202-32780224 AGGCCCCAGGATGCATTCTTAGG - Intronic
1172919097 20:38466509-38466531 TGGTCCCTAAATGTATTTTCTGG + Intergenic
1185057599 22:48589067-48589089 GGGTCTGAAGATGGATTTTCTGG - Intronic
1185363314 22:50422540-50422562 AGGTGCCAAAACACATTTTCAGG + Intronic
952100590 3:30007996-30008018 GGGTCCAAAGATGTATTTTTAGG - Intronic
953443222 3:42937711-42937733 AACTTCCAAGATGCCTTTTCTGG + Exonic
959037699 3:101385571-101385593 GGGTCACAAGATGTATTCTCTGG - Intronic
962728643 3:138259071-138259093 AGGACCTAAGATGCTTTTGCAGG + Intronic
963705373 3:148680533-148680555 AGGTTTCAGGATGCATTTCCTGG + Intergenic
964009857 3:151879347-151879369 AGGTTCCAACATACATTTTGAGG - Intronic
964642704 3:158927309-158927331 AGGGCCCAATGTGCATTTTGAGG - Intergenic
966568864 3:181417582-181417604 AGGCCACAAAATGCATCTTCTGG + Intergenic
967130990 3:186470556-186470578 AGGCCACAAGGTGCAATTTCTGG + Intergenic
972838592 4:42904993-42905015 TGGTACCAAGATGCCTTTTACGG - Intronic
972870970 4:43297487-43297509 AGGTAACTAGATCCATTTTCTGG + Intergenic
978132497 4:105215240-105215262 AGGTCTCATGTAGCATTTTCTGG - Intronic
978598409 4:110402919-110402941 AGGTGCCAAGATGGAATGTCAGG - Intronic
982426124 4:155263305-155263327 AGGTTCCAAGATGCATGTGTGGG + Intergenic
985230613 4:187811962-187811984 AAGTACCATGATTCATTTTCAGG - Intergenic
990940203 5:61194912-61194934 AGGTTCCAGGATGCATGTGCAGG + Intergenic
992237439 5:74725684-74725706 AGGTGCCAGGATGAATTGTCAGG + Exonic
993118549 5:83746747-83746769 AGGTCCCCAGCCGCATCTTCTGG - Intergenic
993356759 5:86922471-86922493 AGGTACAAAGATGAATTTGCAGG - Intergenic
994855585 5:105114763-105114785 AGGTCCCAAGACTCATCTTGTGG - Intergenic
997524580 5:134544123-134544145 AGGTAGAAAGCTGCATTTTCAGG + Intronic
999629461 5:153555033-153555055 AGGTTCCAAGCTGCATGTCCTGG - Intronic
999990624 5:157046812-157046834 AAGGCCCAAGTTACATTTTCTGG - Intronic
1002337264 5:178488534-178488556 AGGTCTCATGTTGCATTTTAAGG - Intronic
1004013873 6:11714632-11714654 AGGTGACAAGATGCAGTTTAAGG + Intronic
1004560284 6:16743281-16743303 AGGTCCAATGATGAATTTTCTGG - Intronic
1006788321 6:36682636-36682658 AAGTCCCAACTTGCAGTTTCTGG - Intronic
1007153679 6:39721296-39721318 AGGTTCCATGAGACATTTTCAGG + Intronic
1009814092 6:68708362-68708384 AGGACCCCAGATACATTTTGAGG - Intronic
1011035355 6:82968130-82968152 AGGCCCCAAAATGCAATTGCTGG + Intronic
1011456593 6:87556950-87556972 AAGACTCAAGATGCATTTTGGGG - Intronic
1014626124 6:123728189-123728211 AGGTTCCAGTATTCATTTTCAGG + Intergenic
1016524494 6:144986306-144986328 TGGTCACAAGATGTATTTCCAGG + Intergenic
1018974880 6:168556574-168556596 AGATCCCAAGGCGCATTTTGGGG - Intronic
1022069760 7:26901252-26901274 ATCTCCCAACATGCAATTTCTGG - Intronic
1026969904 7:74461391-74461413 GGGTCTCAAGGTGCATTTTCTGG + Intronic
1029151480 7:98483681-98483703 TGATCCCAGGAAGCATTTTCAGG - Intergenic
1032755292 7:134884589-134884611 ACCTCCCAAGATCCAATTTCTGG + Intronic
1033140511 7:138822258-138822280 AGCTCACAAGCTGCATTTTTAGG - Intronic
1035831588 8:2700584-2700606 AGGACTCAACATTCATTTTCAGG - Intergenic
1036603972 8:10290210-10290232 AGGTCCCAAGAAGCACTGCCTGG + Intronic
1039196813 8:35041377-35041399 ATGTCCCAAGATCCCTTTTCAGG + Intergenic
1039656059 8:39409016-39409038 AGTTCCCTAGCTGCATTCTCAGG - Intergenic
1039881547 8:41628322-41628344 AGGTCCCAAAATGCATTTTTTGG + Intergenic
1040604656 8:48919980-48920002 GGGTCCGAATATGCATCTTCAGG + Exonic
1042880911 8:73487635-73487657 ATGTCCCAAGATGCCTTATGTGG - Intronic
1043860971 8:85316796-85316818 AGGTCTCAAGAGCCATTTTAAGG + Intergenic
1046722185 8:117632872-117632894 ATGTCACTAGCTGCATTTTCAGG - Intergenic
1048162276 8:132032328-132032350 AGGACCCAAGATGCTGTTTGGGG + Intronic
1048673637 8:136752077-136752099 TGGTCACAAGATGTATTTTCTGG + Intergenic
1051266718 9:15316366-15316388 AGGTTCCAACATGAATTTTAGGG - Intergenic
1053132360 9:35623572-35623594 AGGTCACAAGACACAATTTCTGG - Intronic
1055737726 9:79350116-79350138 AAGTTCCCAGATGAATTTTCAGG + Intergenic
1058845597 9:108955308-108955330 TGGTCCCAAGATCCCTTTTGGGG - Intronic
1059158059 9:112007118-112007140 TGGTCCTAAAATGCACTTTCAGG + Intergenic
1061670783 9:132187045-132187067 AGGAACTGAGATGCATTTTCTGG + Intronic
1188908273 X:35814073-35814095 AGATTTCAAGAGGCATTTTCTGG + Intergenic
1191993937 X:67069597-67069619 AGGTGCCAAGATTCACATTCAGG + Intergenic
1194314217 X:92354589-92354611 AGGTCTCTTGATTCATTTTCTGG + Intronic
1197537062 X:127703191-127703213 AGGTTCCAACTTGCATTTTATGG + Intergenic
1201334130 Y:12861513-12861535 AAATCCCAAGATACATTTCCAGG - Intergenic