ID: 1162797792

View in Genome Browser
Species Human (GRCh38)
Location 19:13095588-13095610
Sequence GGGCAGGGGCAGGAACTGAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 495}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162797792_1162797814 28 Left 1162797792 19:13095588-13095610 CCCATCAGTTCCTGCCCCTGCCC 0: 1
1: 0
2: 2
3: 40
4: 495
Right 1162797814 19:13095639-13095661 GCCGGAGGGTGGAGCAGAAAGGG 0: 1
1: 0
2: 4
3: 40
4: 334
1162797792_1162797803 1 Left 1162797792 19:13095588-13095610 CCCATCAGTTCCTGCCCCTGCCC 0: 1
1: 0
2: 2
3: 40
4: 495
Right 1162797803 19:13095612-13095634 TCATGCAGACTGCCCTGCTGGGG 0: 1
1: 0
2: 2
3: 17
4: 241
1162797792_1162797808 13 Left 1162797792 19:13095588-13095610 CCCATCAGTTCCTGCCCCTGCCC 0: 1
1: 0
2: 2
3: 40
4: 495
Right 1162797808 19:13095624-13095646 CCCTGCTGGGGCCGGGCCGGAGG 0: 1
1: 1
2: 4
3: 51
4: 545
1162797792_1162797805 6 Left 1162797792 19:13095588-13095610 CCCATCAGTTCCTGCCCCTGCCC 0: 1
1: 0
2: 2
3: 40
4: 495
Right 1162797805 19:13095617-13095639 CAGACTGCCCTGCTGGGGCCGGG 0: 1
1: 0
2: 1
3: 67
4: 540
1162797792_1162797813 27 Left 1162797792 19:13095588-13095610 CCCATCAGTTCCTGCCCCTGCCC 0: 1
1: 0
2: 2
3: 40
4: 495
Right 1162797813 19:13095638-13095660 GGCCGGAGGGTGGAGCAGAAAGG 0: 1
1: 0
2: 2
3: 57
4: 412
1162797792_1162797810 14 Left 1162797792 19:13095588-13095610 CCCATCAGTTCCTGCCCCTGCCC 0: 1
1: 0
2: 2
3: 40
4: 495
Right 1162797810 19:13095625-13095647 CCTGCTGGGGCCGGGCCGGAGGG 0: 1
1: 0
2: 3
3: 35
4: 385
1162797792_1162797802 0 Left 1162797792 19:13095588-13095610 CCCATCAGTTCCTGCCCCTGCCC 0: 1
1: 0
2: 2
3: 40
4: 495
Right 1162797802 19:13095611-13095633 CTCATGCAGACTGCCCTGCTGGG 0: 1
1: 0
2: 0
3: 42
4: 647
1162797792_1162797816 29 Left 1162797792 19:13095588-13095610 CCCATCAGTTCCTGCCCCTGCCC 0: 1
1: 0
2: 2
3: 40
4: 495
Right 1162797816 19:13095640-13095662 CCGGAGGGTGGAGCAGAAAGGGG 0: 1
1: 0
2: 1
3: 26
4: 349
1162797792_1162797806 10 Left 1162797792 19:13095588-13095610 CCCATCAGTTCCTGCCCCTGCCC 0: 1
1: 0
2: 2
3: 40
4: 495
Right 1162797806 19:13095621-13095643 CTGCCCTGCTGGGGCCGGGCCGG 0: 1
1: 0
2: 5
3: 68
4: 588
1162797792_1162797804 5 Left 1162797792 19:13095588-13095610 CCCATCAGTTCCTGCCCCTGCCC 0: 1
1: 0
2: 2
3: 40
4: 495
Right 1162797804 19:13095616-13095638 GCAGACTGCCCTGCTGGGGCCGG 0: 1
1: 0
2: 2
3: 42
4: 357
1162797792_1162797811 17 Left 1162797792 19:13095588-13095610 CCCATCAGTTCCTGCCCCTGCCC 0: 1
1: 0
2: 2
3: 40
4: 495
Right 1162797811 19:13095628-13095650 GCTGGGGCCGGGCCGGAGGGTGG 0: 1
1: 0
2: 8
3: 161
4: 1274
1162797792_1162797801 -1 Left 1162797792 19:13095588-13095610 CCCATCAGTTCCTGCCCCTGCCC 0: 1
1: 0
2: 2
3: 40
4: 495
Right 1162797801 19:13095610-13095632 CCTCATGCAGACTGCCCTGCTGG 0: 1
1: 0
2: 2
3: 16
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162797792 Original CRISPR GGGCAGGGGCAGGAACTGAT GGG (reversed) Exonic
900108484 1:996226-996248 GGGGAGGGGCAGGAAATGTCTGG + Intergenic
900182149 1:1315803-1315825 AGGCAGGGGCAGGGAGTGAGGGG + Intronic
900336949 1:2169155-2169177 GGGCTGGGACAGGATCTGCTGGG - Intronic
900479018 1:2889404-2889426 GGGCAGGGACAGGGACAGAAGGG - Intergenic
900524210 1:3120595-3120617 GGACAGGGGCAGGGACAGAGGGG - Intronic
900697501 1:4021357-4021379 GGGGAGAGGCAGGAGCAGATGGG - Intergenic
901056432 1:6450569-6450591 GGGCAGGGGCAGGGGCTGGCAGG + Intronic
901221874 1:7587993-7588015 GGCCAGGGCCAGGCACCGATAGG - Intronic
901529132 1:9842743-9842765 GGGCAGGTGCAGGAACTCTAAGG + Intergenic
901644307 1:10708536-10708558 GGGCAGGTGCAGCAGCCGATAGG - Intronic
902264851 1:15255998-15256020 GGGCAGGGGCAGATTCTGAAAGG - Intronic
902477914 1:16697916-16697938 GGGCAGGGGCAGGGGCTGGCAGG - Intergenic
902796974 1:18806375-18806397 GGTGAAGGGCAAGAACTGATTGG - Intergenic
902828746 1:18995833-18995855 GGGCAGGGGCAGGGGGTGAGGGG + Intergenic
903169219 1:21541723-21541745 GGGCAGGGGGAGGGATTCATTGG + Intronic
903283844 1:22265044-22265066 GGTCAGGGGAAGCAGCTGATTGG + Intergenic
904375066 1:30075773-30075795 GGGCAGAGGCTGGAACAGTTTGG + Intergenic
904673123 1:32180541-32180563 GGGCAGGGGGAGGAGCTGTGGGG + Intronic
904689061 1:32280216-32280238 AGCCAAGGGCAGGAACTGAAAGG + Intronic
904840721 1:33370297-33370319 GGGCAGGGGCAGGAGATAAGGGG - Intronic
904899080 1:33842086-33842108 GGTCTGGGGCAGAAACAGATGGG - Intronic
905891610 1:41521789-41521811 CGGCAGGGGCAGGGACAGAGCGG - Intronic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
906165711 1:43684618-43684640 GGGCAAGGCCAGGGAGTGATAGG + Intronic
906594187 1:47059542-47059564 GGGCAGAGTCAGGAAATTATTGG - Intergenic
906649964 1:47505925-47505947 GGGCAGGGGAAGGAAGGGAAAGG + Intergenic
907029562 1:51157638-51157660 GGGAAGGGGGAGGAACAGGTGGG + Intergenic
907297267 1:53463276-53463298 GGGCAGGGACAGGAACAGGAAGG - Intronic
908408809 1:63842859-63842881 GGGAAGGGGGAGGAACAGGTTGG + Intronic
908436567 1:64112707-64112729 GGGCAGGGACAGAAACTTGTGGG - Intronic
908795941 1:67832128-67832150 GGGGAGAGGAAGTAACTGATGGG + Intronic
910217403 1:84856057-84856079 GCGTAGGGGCAGCAACTGAGTGG + Intronic
910867265 1:91799817-91799839 GGGCAGGGGCAAAAACTCAATGG + Intronic
912508404 1:110172227-110172249 GGGCTGGGGCAGGCACTGAGTGG + Intronic
913193201 1:116431019-116431041 GGGCAGGGGCAGGAAAGGATTGG + Intergenic
913309426 1:117473394-117473416 GGGCAGAGGCAGAAACAGAAAGG - Intronic
914205005 1:145519077-145519099 ATACAGGGGCAGGAGCTGATGGG - Intergenic
914231735 1:145768185-145768207 GGGGATGGGCAGGATCTGAGCGG - Intronic
914484124 1:148092259-148092281 ATACAGGGGCAGGAGCTGATGGG - Intergenic
915489878 1:156245043-156245065 GGGCTGAGGCAGGGACTGAGGGG + Intronic
915552985 1:156646059-156646081 CAGCAGGGGCAGGAACAGCTGGG - Exonic
916190964 1:162177744-162177766 GTGCAGGGGCAGGAATATATGGG - Intronic
917515578 1:175704925-175704947 GGGCAGGGGAGGGAAGTGAGGGG + Intronic
918711631 1:187737722-187737744 GGGCAGGGGTTGGAACAGTTTGG - Intergenic
919788900 1:201277432-201277454 GGGCAGGGGCGGGAACAGTAGGG - Intergenic
919802275 1:201361142-201361164 GGGCAGATGCAGGAGCTGAAGGG + Intronic
922371629 1:224917034-224917056 GGGCTGGGGGAGAATCTGATCGG + Intronic
922412232 1:225387937-225387959 GGGCAGGGGCAGGGGCAGCTGGG + Intronic
922979878 1:229816696-229816718 GGGGTGGGGCAGGAACTGGAAGG + Intergenic
923498111 1:234542353-234542375 GGACAGTGGCAGGAGCTGTTAGG - Intergenic
924235146 1:241993991-241994013 GGGAAGGGGAAGGAACAGGTGGG - Intergenic
924370178 1:243339135-243339157 GGGCAGAGGAAGGGAATGATGGG + Intronic
1062798900 10:364788-364810 GTGGAGGTGCAGGAACGGATGGG - Intronic
1063065121 10:2600139-2600161 GTGCAGGGGCAGGTCCTGTTGGG - Intergenic
1063178173 10:3570863-3570885 GGACAGGGGCAGGGGCTGAGGGG + Intergenic
1064102290 10:12474125-12474147 GGGGAGGGGCAGGAAGCAATAGG + Intronic
1065852653 10:29803713-29803735 GGAAAGGGGCAGGAAATGAGTGG + Intergenic
1067142471 10:43668639-43668661 GGGTAGGGGCAGGAAGAGTTGGG - Intergenic
1067146959 10:43701153-43701175 GGCCAGGGGCTGGGACTGAAGGG + Intergenic
1067438830 10:46296879-46296901 GGGCAGAGGGAGGAGCTGCTGGG - Intronic
1067452266 10:46389256-46389278 GGGCAGGGGCAAGAGAGGATTGG + Intronic
1067584971 10:47470499-47470521 GGGCAGGGGCAAGAGAGGATTGG - Intronic
1068184106 10:53563474-53563496 GGGCAGAGGCTGGAACAGTTTGG + Intergenic
1068610516 10:59055086-59055108 GAGCAGTGGCAGAAAATGATGGG - Intergenic
1068634985 10:59338797-59338819 GGGAACTGGCAGGAACTGATGGG - Intronic
1069256843 10:66343576-66343598 GGTCAGGGGAAGGGAGTGATAGG + Intronic
1070286105 10:75085122-75085144 TGCCTGGGGCAGGAACTGAAAGG - Intergenic
1070316813 10:75321422-75321444 AGGCAGAGGCAGGAACAGTTTGG + Intergenic
1071002978 10:80852144-80852166 AGGCAGGGACAGGGACTGTTGGG + Intergenic
1071177842 10:82947107-82947129 GGACAGGAGTAGGGACTGATAGG - Intronic
1071757687 10:88562534-88562556 GGGCAGGGCCAGGAATAAATAGG + Intronic
1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG + Intronic
1072618159 10:97063301-97063323 GGGCAGGGTCAGGAGGTGATGGG + Intronic
1072618173 10:97063338-97063360 GGGCGGGGTCAGGAGGTGATGGG + Intronic
1072620015 10:97073588-97073610 GGGCTGGGGCAGAAGCTGAAGGG + Intronic
1073292160 10:102418802-102418824 GGGTAGGGGGAGGGACTGAGAGG - Exonic
1073334823 10:102698593-102698615 GGGCTGGTGAAGGAACTGAGAGG + Intronic
1075737205 10:124671275-124671297 GGGCTGGGGCAAGACCTGAGAGG - Intronic
1076405804 10:130211987-130212009 GGCCAGAGGCTGGAACTGAAGGG - Intergenic
1076599827 10:131650351-131650373 AGGCCGGGCCAGGAACTGACTGG + Intergenic
1076723666 10:132403781-132403803 GGGCAGGAGCAGCCACTGCTGGG - Intronic
1076883917 10:133252601-133252623 GGGCAGGGTCAGGAGCAGAGTGG - Intergenic
1077412812 11:2411310-2411332 GGGCAGGGGCAGGGAGAAATTGG - Intronic
1077853612 11:6099800-6099822 GGCCAGGGGGAGGCACTGGTGGG - Intergenic
1078107751 11:8369396-8369418 GGGCAGTGGGAGGGGCTGATGGG + Intergenic
1078171673 11:8933090-8933112 GGGGTGGGGCAGGAAGTGATGGG + Intergenic
1079313980 11:19391684-19391706 GGGGAGGGGCAGGAACTGGGGGG + Intronic
1079819440 11:25106473-25106495 GGGCAGAGGTAGGAACAGTTTGG - Intergenic
1079933104 11:26589601-26589623 GGCCAGGGGCAGGGACTTTTGGG - Intronic
1081685226 11:45037785-45037807 GGGCAAAGGCAGAAACTGAATGG - Intergenic
1082009661 11:47441651-47441673 GGGCAGGTGCAGGCGCTGCTGGG - Exonic
1083225424 11:61281646-61281668 GGGCGGGGCCAGGAGCTGAGAGG + Intronic
1083305837 11:61761558-61761580 GGGCAGGGGCAGGACCTGGAGGG + Intronic
1083878467 11:65536981-65537003 GGGCTGGGGCAGGAACTCCTGGG - Exonic
1083982755 11:66186899-66186921 AGGCAGGTGGAGGCACTGATTGG - Intronic
1084026332 11:66452376-66452398 TGGCAGGGGCTGGATCTGAAGGG + Intronic
1084177968 11:67433279-67433301 GGGCAAGGGCAGGGCCTGGTGGG + Intronic
1084240809 11:67818441-67818463 GGAAAGGGGCAGGAACTCCTGGG + Intergenic
1084321185 11:68374135-68374157 GGGCAGCGGGAGGAACAGAGGGG + Intronic
1084600903 11:70144922-70144944 GGGCCGGGGCAGGATCCGAGGGG + Intronic
1085259444 11:75195884-75195906 GGGCAGGGGCAGGATGTCAGAGG - Intronic
1088626014 11:111731265-111731287 GGGCAGGGGCTGGAAATGGGAGG + Intronic
1089154417 11:116389977-116389999 GGGCAGAGGCTGGAACTGTTTGG - Intergenic
1089215470 11:116832132-116832154 GGGCAGGGGCAGGATGGGAGAGG - Intronic
1089332195 11:117697591-117697613 GGGCTGGGGCAGGAAGGAATGGG - Intronic
1089540332 11:119185972-119185994 GGGCAAGGGGAGGAAATAATTGG + Intronic
1089572227 11:119418429-119418451 CAGCAGGGGCTGGCACTGATGGG + Exonic
1091043590 11:132305351-132305373 GGGTCGGAGCAGGGACTGATAGG - Intronic
1091704916 12:2687213-2687235 GGGCAGGGGCAGGAGGTGGAAGG + Intronic
1092152849 12:6262948-6262970 GGGCAGAGGCAGGAACTCAGGGG + Intergenic
1093019671 12:14191901-14191923 GGGCAGTGGGAGAACCTGATGGG - Intergenic
1095162597 12:38935260-38935282 GGACAGGGGCAGTTACTAATAGG + Intergenic
1096073789 12:48789559-48789581 GGGCAGGGGCAGGGAGGAATTGG - Intergenic
1096420803 12:51455739-51455761 GGGGAGGGGTAAGCACTGATGGG + Intronic
1096840875 12:54378787-54378809 GGGCAGGTGTAGGACCTGACAGG + Intronic
1097184582 12:57189723-57189745 GGGCGGGGGCAGGTCCTGTTAGG + Intronic
1098212304 12:68179397-68179419 GGACAAGGGCAGAAACTGAGAGG + Intergenic
1100697706 12:97113581-97113603 GGGCAGTGGCAGGAACACACAGG + Intergenic
1101373907 12:104154372-104154394 GGGCAAGAGCAGGAAATGCTGGG + Intergenic
1101693753 12:107105570-107105592 GGGCAGGTGAAGGGACTGGTGGG - Intergenic
1103609841 12:122116614-122116636 GGGCAGGGGCAGGGACCCCTGGG - Intronic
1103701981 12:122853025-122853047 AGGCAGGAGCAGGACCTGAGGGG + Intronic
1104752076 12:131246125-131246147 TGGCAGGGGCAGTCACCGATGGG - Intergenic
1105007068 12:132728079-132728101 GTGCACGGCCGGGAACTGATGGG + Exonic
1105348330 13:19593958-19593980 GGGCAGAGGGAGGAAAAGATAGG + Intergenic
1105454310 13:20525996-20526018 GGGCAGGGGCAGGACCAGCGCGG + Intergenic
1106505724 13:30369048-30369070 GGGTTGGAGCAGGAAATGATGGG - Intergenic
1107371824 13:39759061-39759083 GGACAGGGAGAGGAACTGATCGG + Intronic
1108100143 13:46945713-46945735 AGGCAGAGGCTGGAACTGTTTGG - Intergenic
1108473144 13:50787689-50787711 GGGCAGGGGAATGACATGATTGG - Intronic
1108930203 13:55808073-55808095 GGGCAGAGGCTGGAACAGTTTGG - Intergenic
1110083485 13:71346565-71346587 AGGCAGAGGCTGGAACCGATTGG - Intergenic
1110368916 13:74718705-74718727 GGGCAGGGGGTGGCACTGGTTGG - Intergenic
1110854128 13:80278628-80278650 GGGCAGGGCTAGGGACTGGTGGG - Intergenic
1111753152 13:92359435-92359457 GGGCAGAGGTAGGAACAGTTTGG - Intronic
1112489352 13:99848051-99848073 GGGCAGCGGCAGGAACAGTGAGG - Intronic
1113009886 13:105751941-105751963 GGGCAGGAGAAGCAACTTATTGG - Intergenic
1113641914 13:111963661-111963683 GGGCAGGGGCAGGGTTTGTTGGG + Intergenic
1114186108 14:20403703-20403725 GGGCTGGGGCAGTGACTGACTGG + Exonic
1114635178 14:24183194-24183216 GGGGAGGGGCAGGGCCTGACTGG - Intronic
1114701061 14:24679055-24679077 GAGCAGCCGCAGGAACTGAAAGG - Intergenic
1115199219 14:30835139-30835161 GGGCAGAGGTAGGAACAGTTTGG - Intergenic
1116304176 14:43229367-43229389 GAGCAAGGGCAGGAGCAGATGGG + Intergenic
1116965535 14:51010962-51010984 GGGGAGGGGCAGGAAGGGAAAGG - Intronic
1118198219 14:63648090-63648112 GGGAAGGGGGAAGTACTGATTGG + Intergenic
1119210242 14:72826000-72826022 GGGCAGGGGCGGGAAAGGAAGGG + Intronic
1119405307 14:74395165-74395187 GGGCAGGGGCCGGAGCTGGCTGG + Intergenic
1119475814 14:74927239-74927261 GGGCAGTGGAAGGAAATGTTCGG + Intergenic
1120813724 14:88831257-88831279 GGAAAGGGGCAGTAACTTATAGG - Intronic
1121450619 14:94004791-94004813 GGGCAGGGGCAGGGGATGCTGGG + Intergenic
1121732741 14:96197794-96197816 GGTCAGGTGAAGGAGCTGATTGG + Intergenic
1122119305 14:99543365-99543387 GGGCAGGGGCAGTATATTATTGG + Intronic
1122201113 14:100123262-100123284 GAGCAGGGTCAGTAACTGAAAGG + Intronic
1122242215 14:100376390-100376412 GGGCAGAGGCCGCCACTGATTGG + Exonic
1123222861 14:106872898-106872920 GGGAAGGGGCTGGAATGGATTGG - Intergenic
1123480237 15:20624384-20624406 TGGCAAGTGCAGGAACTGATGGG + Intergenic
1123637769 15:22375979-22376001 TGGCAAGTGCAGGAACTGATGGG - Intergenic
1123815359 15:23972619-23972641 GGGAATGGGCAGTAACTAATGGG + Intergenic
1124271295 15:28282952-28282974 GGGAAGGGACAGGAAGGGATGGG + Intronic
1124510102 15:30316633-30316655 GGTCAGCGGCAGGAACTCCTTGG - Intergenic
1124732787 15:32213920-32213942 GGTCAGCGGCAGGAACTCCTTGG + Intergenic
1124864047 15:33471877-33471899 GGTCAGGGGCAGGTAATGAGGGG - Intronic
1125003714 15:34795791-34795813 GGGGAGGGGCAGGCGCTGAAGGG + Exonic
1125632895 15:41162440-41162462 GGGCAAGGGCAAGAAATGAAGGG + Intergenic
1125741271 15:41966483-41966505 GGGCAGGGGCATGAAATGTGGGG - Intronic
1125930179 15:43594393-43594415 AGGCGGGGGCAGGAGGTGATGGG + Intronic
1125943347 15:43694225-43694247 AGGCGGGGGCAGGAGGTGATGGG + Intronic
1126069623 15:44854542-44854564 GGGCAGCGGGAGGAGCTGAAGGG - Intergenic
1126587943 15:50308472-50308494 GGGCAAGGGCAGGAGCAGACAGG + Intronic
1127632068 15:60836819-60836841 GGGCAGAGGGGGGAGCTGATTGG - Intronic
1128883546 15:71265003-71265025 GGGCAGGGCCCTGATCTGATAGG + Intronic
1128982319 15:72196976-72196998 GGACCGGGGCAGGAATTGACAGG + Intronic
1129360590 15:75021555-75021577 GGGCAGGGGCATGAAAGTATGGG + Intergenic
1129715279 15:77844635-77844657 GGGCAGAGGCTGGAACAGTTTGG + Intergenic
1129908848 15:79209401-79209423 GGGGAGGAGCAGGACCTGCTGGG + Intergenic
1130272383 15:82458813-82458835 GGGTGGGGGCAGGAGCTTATTGG - Intergenic
1130401453 15:83558654-83558676 AGCCAGGGGCAGGAATGGATAGG - Intronic
1130464734 15:84186166-84186188 GGGTGGGGGCAGGAGCTTATTGG - Intergenic
1130483911 15:84387095-84387117 TGGCAAGGGCAGGGACTGAGCGG - Intergenic
1130487951 15:84408638-84408660 GGGTGGGGGCAGGAGCTTATTGG + Intergenic
1130499532 15:84487371-84487393 GGGTGGGGGCAGGAGCTTATTGG + Intergenic
1130587026 15:85190780-85190802 GGGTGGGGGCAGGAGCTTATTGG - Intergenic
1130605491 15:85312819-85312841 GGGCAGGGGGAGGGACAGAAGGG + Intergenic
1131290431 15:91102016-91102038 GGGCTGGGACAAGAACAGATAGG - Intronic
1132036264 15:98487325-98487347 AGGCAGCTGGAGGAACTGATGGG - Intronic
1132071925 15:98785994-98786016 GGGGAGGGGCAGCAGCTGAAAGG - Intronic
1132891197 16:2205657-2205679 GGCCAGCGGCAGGCCCTGATGGG - Intronic
1133020031 16:2963295-2963317 GGCCGGGGGAAGGAACTGGTGGG - Intergenic
1133222530 16:4324954-4324976 GGGCAGGGGCAGGGCCTGCTGGG - Intronic
1133306247 16:4811507-4811529 GGCCAGGGTCAGGGACTGACTGG + Intronic
1133412535 16:5580307-5580329 GAGCAGCTGCAGGGACTGATTGG + Intergenic
1133737926 16:8629813-8629835 GAGCTGGGCCAGGAAGTGATCGG + Intronic
1134016377 16:10891292-10891314 GGGCAGGGGCAGCCACCGACAGG + Intronic
1134164150 16:11916281-11916303 GGGCAGCGGCAGGCCCTGGTTGG + Intergenic
1134310638 16:13072403-13072425 GGGCCAGGGGAGGAAGTGATGGG + Intronic
1135026945 16:19006032-19006054 GGGCAGGGGCAGGGCCAGGTGGG - Intronic
1135156762 16:20059351-20059373 GAGAAGGGGCAGGAGATGATGGG - Intronic
1136778743 16:32884787-32884809 GGGCAGGGAGAGGAACAGAGTGG + Intergenic
1137936215 16:52637802-52637824 GTGCAGGAGAAGGAAGTGATGGG + Intergenic
1138621303 16:58213239-58213261 GGCCAGGTGCAGTAACTAATTGG + Intergenic
1139339368 16:66257996-66258018 GGGCAGGGGCAGGAGCAAGTAGG - Intergenic
1139839697 16:69868373-69868395 GGGCAGGGCCAGGGAGTAATGGG + Intronic
1140194613 16:72846110-72846132 GGGCAGGGGCAGGAAGGAGTGGG + Intronic
1140428636 16:74882929-74882951 GGGCAGTGGCAGGGAATGCTGGG - Intronic
1141141334 16:81498572-81498594 GGGCAGGGGCATGGAGGGATGGG - Intronic
1141237556 16:82232602-82232624 GGGCATTGGCAGGCACTGAATGG + Intergenic
1141594479 16:85088865-85088887 GGGCAGGAACAGGAAGTGACGGG + Exonic
1141615284 16:85206649-85206671 GGGCAGGGGCAGGAGAGGAAGGG - Intergenic
1141667465 16:85473318-85473340 GGGCAGGGCCAGGAGCTGGTGGG + Intergenic
1141832305 16:86516634-86516656 GAGCAGGGGCAGGAGCTGCTTGG + Intergenic
1142597912 17:1038577-1038599 GGGCTGGGGCAGGGAGGGATGGG - Intronic
1142968517 17:3595872-3595894 GGGGTGGGACAGGAACTGAGGGG + Intronic
1143096543 17:4481297-4481319 GAGCAGGGGCAGGAAGTGTGTGG + Intronic
1143782481 17:9236579-9236601 GGGCAGGGACAGGTAGTGGTAGG - Intronic
1144626436 17:16846549-16846571 GGGCAGGGTCAGAAGCTGACTGG - Intergenic
1144879997 17:18426162-18426184 GGGCAGGGTCAGAAGCTGACTGG + Intergenic
1145063194 17:19744993-19745015 GAGCAGGAGCAGGAGCTGGTGGG - Exonic
1145152236 17:20518222-20518244 GGGCAGGGTCAGAAGCTGACTGG - Intergenic
1145304444 17:21665558-21665580 GTTCAGGGACAGGAACTGGTGGG + Intergenic
1145921831 17:28615536-28615558 GGGCAGGTGCATGAAGTGAGTGG - Intronic
1145990579 17:29077089-29077111 GGGCAGTGGCAGGAGCTGCCGGG + Exonic
1146163591 17:30572438-30572460 GGGCAGGGACAGAAGCTGACTGG - Intergenic
1147580583 17:41625257-41625279 GGGCAGGGTCAGAAGCTGACTGG - Intergenic
1147887126 17:43691536-43691558 GGGCAGTGGGAGGAACTGAGAGG + Intergenic
1149450529 17:56746557-56746579 GGGCAGGGGCAGTTTCTGCTGGG - Intergenic
1149651954 17:58281080-58281102 GGGAAGGGGCAGGAAAGGAGGGG + Intergenic
1149696452 17:58620175-58620197 GGGCAGAGGCAGGAGATGAAGGG + Intronic
1150006871 17:61475426-61475448 GAGCAGGGGAGTGAACTGATGGG + Intronic
1150223354 17:63509474-63509496 GGGGAGGGGCAGGGACAGACAGG - Intronic
1151040941 17:70860545-70860567 GGGCAGAGGCTGGAACAGTTTGG + Intergenic
1151579115 17:74968267-74968289 TGGCAAGGTCAGGGACTGATGGG - Intronic
1151966888 17:77436223-77436245 GGGAAAGGGCAGGAACAGAGAGG + Intronic
1152294114 17:79456738-79456760 GGGCAGAGGCAGGCTCTGAAGGG - Intronic
1152533785 17:80938340-80938362 GGGAAGGGAGAGGAACTGATGGG - Intronic
1152789826 17:82273086-82273108 GGGGAGGGGCAGGACCAGGTCGG - Intronic
1152830503 17:82494407-82494429 AGCCAGGAGCAGGTACTGATGGG + Intergenic
1152887375 17:82860350-82860372 GTGGAGGGGCAGGAACTGACTGG + Intronic
1153254119 18:3153028-3153050 GGGCTGTGGCAGAAGCTGATAGG + Intronic
1153330284 18:3866779-3866801 GGGCAGGGGCTGGGACTGGAAGG + Intronic
1155089088 18:22488869-22488891 GGCCAGGGGAAGGAAATGCTGGG + Intergenic
1155142768 18:23057849-23057871 CGGCAGGGGCAGGAAAGGACTGG + Intergenic
1155410944 18:25544078-25544100 GGGAAAGGGAAGGAACTCATGGG - Intergenic
1155450034 18:25953692-25953714 GGGCAGGGACAGAAAGTGAAAGG + Intergenic
1157699792 18:49754724-49754746 GGGGAGGGGCTGAAACTTATGGG - Intergenic
1158838867 18:61361616-61361638 GGTCATGGGCAGGCACTGGTTGG - Intronic
1159127979 18:64247126-64247148 GTGCAGGGGCAGGAATGGAAAGG - Intergenic
1159337053 18:67081910-67081932 AGGCAGGGGCAGTAACTTTTAGG - Intergenic
1160665324 19:325445-325467 GGGCAGGGGCAGGCAGCAATAGG + Intronic
1160905279 19:1449115-1449137 GGGCTGGTGCAGGGAATGATAGG - Intronic
1161622141 19:5303636-5303658 GAGCAGGGGCAGGATTTGAGGGG + Intronic
1162043100 19:7982142-7982164 GGGCAAGGGCAGGACCAGAGGGG + Intronic
1162797792 19:13095588-13095610 GGGCAGGGGCAGGAACTGATGGG - Exonic
1162926998 19:13935798-13935820 GGACCGGGGCAGAAACTGAGGGG + Exonic
1163763052 19:19147318-19147340 GGGCAGGGGGAGGAGCAGGTAGG - Intronic
1163792271 19:19314574-19314596 GGGCAGGCCCAGGAACTGAGGGG - Intronic
1165092991 19:33396359-33396381 GGGCCGGGGCAGGTGCTGCTGGG + Intronic
1165108870 19:33489716-33489738 GGGCAGGGGCAGGCACAGGTGGG - Intronic
1165122893 19:33573601-33573623 GGGCTGGGGCAGGAAGGTATGGG + Intergenic
1165890882 19:39111653-39111675 GAGCAGGTGAAGGAAGTGATCGG + Intergenic
1166164763 19:40979574-40979596 GGGCTGGGGGAGCTACTGATGGG - Intergenic
1166532248 19:43550053-43550075 GGGCAGGGGCAGGCTCTGTTGGG - Intronic
1166745568 19:45140397-45140419 GGGCAGGGGCTGGGCCTGGTGGG + Intronic
1167091357 19:47346255-47346277 GGGAAGGGGCAGTAACTCCTGGG - Intergenic
1167091368 19:47346296-47346318 GGGAAGGGGCAGTAACTTCTGGG - Intergenic
1167331545 19:48859405-48859427 GGGCAGGGCCGGAAACTGGTTGG - Intronic
1167637998 19:50666572-50666594 TGACAGGGGCTGGAACCGATGGG - Exonic
1167650261 19:50724911-50724933 AGGCGGGGCCAGGAACTCATGGG - Intronic
1202711934 1_KI270714v1_random:23743-23765 GGGCAGGGGCAGGGGCTGGCAGG - Intergenic
925253805 2:2465154-2465176 GGCCAGGGGCACGAATTGAGAGG - Intergenic
925481801 2:4283779-4283801 TGCCAGGGGCAGGAACTGATGGG - Intergenic
925498856 2:4482406-4482428 GGGCAGGGTCTGGAACAGTTTGG + Intergenic
925917371 2:8616194-8616216 GAGCAGGAGCTGGAGCTGATGGG - Intergenic
926208419 2:10850405-10850427 GGGCAGAGGAAGCAACAGATAGG - Intronic
926346584 2:11952253-11952275 GCACAGGGGCAGGCACTGTTGGG + Intergenic
926489249 2:13503834-13503856 AGGCTGAGGCAGGATCTGATGGG - Intergenic
926647405 2:15304508-15304530 GGGCAGAGGCTGGAACAGTTTGG + Intronic
927032844 2:19140629-19140651 GGGCAAGGCCAGGAACTTTTGGG + Intergenic
927492745 2:23531393-23531415 GGGTGGGGGATGGAACTGATGGG - Intronic
928127485 2:28626574-28626596 GGGCAGGGCCAGGGATGGATGGG - Intronic
929837001 2:45411546-45411568 AGGTTGGGGCAGTAACTGATCGG + Intronic
930200908 2:48551431-48551453 GGGCAGGGGCAGGGTCAGAGGGG - Intronic
931221740 2:60294972-60294994 GTGCAGGAGCATGAACTGTTGGG - Intergenic
931251242 2:60532057-60532079 GGGCAGAGGCAGGGAGTGCTGGG - Intronic
931585051 2:63816966-63816988 GGGCAGGGGTAAGGACTGATGGG + Intronic
932575323 2:72959498-72959520 GGGAAGGGGCAGGAAGTCAGAGG - Intronic
933508211 2:83205090-83205112 GGGCAGAGGCTGGAACAGTTTGG - Intergenic
935263166 2:101372029-101372051 GGGCAGGAGCTGGAGATGATGGG + Intronic
937913903 2:127089648-127089670 GGGCAGTGGGAGGGACTGAGGGG - Intronic
938142651 2:128809272-128809294 GGGCAGGGGCAGGGAGAAATGGG + Intergenic
938716705 2:134028049-134028071 GGGCAGGGGCGGGAACGGAAGGG - Intergenic
939574396 2:143878953-143878975 GGGCATGAGCAGGAATGGATGGG - Intergenic
941178948 2:162235175-162235197 GGGGAGGGGCAGGAGGTGACAGG - Intronic
941888291 2:170552214-170552236 GGGCAGAGGTAGGAACAGTTTGG + Intronic
942543157 2:177035586-177035608 GGACAGGGACAAGAACAGATTGG + Intergenic
942949550 2:181707151-181707173 GAGCAGGAGGAGGAACAGATAGG - Intergenic
944492501 2:200272144-200272166 GAGCAGAGACAGGTACTGATAGG - Intergenic
944581776 2:201138078-201138100 GGGCAGGGGCATGGACTGCGCGG - Intronic
945175598 2:207040465-207040487 GGACAGGGGCAGAATGTGATTGG + Intergenic
945856308 2:215073551-215073573 GGGCGGGGGCTGCAGCTGATGGG - Intronic
946990082 2:225318705-225318727 GAGCAGGAGCTGGAACTGGTGGG - Intergenic
947461938 2:230310919-230310941 GGGCAGGGGAATGTACTGAAAGG + Intronic
947471022 2:230401131-230401153 GGGCAGGGGAATGTACTGAAAGG + Intronic
947740517 2:232482786-232482808 GGGAAAGGGCAGGAGCTGGTAGG - Intronic
948085077 2:235240728-235240750 AGGCAGGGGCAGGAACCCAGAGG - Intergenic
948220045 2:236262404-236262426 GAGGAGGGGCAGGAGCTGCTGGG + Intronic
948604481 2:239126274-239126296 GGGCAGGGGCAGGGGCAGAAGGG - Intronic
1169044372 20:2524491-2524513 GGGCAGGGGCAGGCAGTGGGGGG - Intronic
1169265011 20:4162171-4162193 GGGCTGGGGCAGGCCCTGAGCGG + Intronic
1169498438 20:6136344-6136366 GGGAAGGGGAAGGAAAGGATAGG - Intergenic
1171521961 20:25782990-25783012 GTTCAGGGACAGGAACTGGTGGG + Intronic
1171554864 20:26072893-26072915 GTTCAGGGACAGGAACTGGTGGG - Intergenic
1173965005 20:47106028-47106050 TGGCAATGGCAGGAACAGATTGG + Intronic
1174058342 20:47815100-47815122 GGGCAGAGACAGGAGCTGAGAGG + Intergenic
1174735950 20:52966006-52966028 GTGTAAGGGCATGAACTGATTGG - Intergenic
1174768068 20:53272383-53272405 GGGCAGGGGCTGCATCTGACTGG + Intronic
1175491575 20:59384022-59384044 GTGGAGGGGAAGGAAGTGATGGG + Intergenic
1175994882 20:62807603-62807625 GGGCAGGGGCAGGTACGTACCGG - Exonic
1176075862 20:63247962-63247984 GGGCAGGCGCAGGAGCGGCTGGG - Intronic
1176125714 20:63473576-63473598 TGGCAGGGGCAGGGACTGGAGGG + Intergenic
1176162336 20:63654031-63654053 GGGGATGGGCAGGATCTGAGCGG + Intergenic
1177492407 21:21844787-21844809 AGGAAGGGGCAAGAAGTGATAGG - Intergenic
1177604578 21:23360952-23360974 GGGCAGAGGCTGGAACAGTTTGG - Intergenic
1178261396 21:31103120-31103142 GGGCAGTGGGAGGAACTCCTAGG - Intergenic
1179594522 21:42433462-42433484 GGGCAAGGTCAGGTCCTGATGGG - Intronic
1179639529 21:42738191-42738213 GGGCCGTGGCAGGAGCTGACCGG + Intronic
1180095176 21:45553086-45553108 GGGCTGGGGCAGGACCGGAGCGG + Intergenic
1180867117 22:19126061-19126083 GGGCAGGGGCCAGAGCTGAAAGG + Intergenic
1181394973 22:22614806-22614828 AGGCATGGGCAGGATCTGAGGGG - Intergenic
1181582975 22:23838060-23838082 GGGCAGGGACAGGCAGTGGTTGG - Intronic
1181607907 22:23991576-23991598 AGGGATGGGCAGGAACTGCTGGG + Intergenic
1182586552 22:31346836-31346858 GTGGGGGGGCAGGAACTGAGGGG + Intergenic
1182953699 22:34401043-34401065 GTGCTGGGGCTGGAATTGATGGG - Intergenic
1183213303 22:36464089-36464111 TGGTAGGGGCAGGCACTGCTCGG + Intergenic
1183262611 22:36805526-36805548 GGGCGGAGGCAGGAAATGCTGGG - Intronic
1183469541 22:37998173-37998195 GGGCAGGGGCAGGGAATGAGGGG + Intronic
1183716311 22:39535460-39535482 GGGCAGGGGCAGCCACTGTTGGG + Intergenic
1184202139 22:42977658-42977680 TGGCAGGGGAGGGACCTGATGGG + Intronic
1184555295 22:45229525-45229547 GCACAGGGGCAGGAATTGACAGG + Intronic
1184684423 22:46089729-46089751 AGGCAGGGGCAGAAGCTGAGTGG - Intronic
1184803126 22:46774578-46774600 GGGCAGGGCCAGGCATTGCTGGG + Intronic
1184871900 22:47245922-47245944 GGGCAGGGGCCGGATCCCATGGG - Intergenic
1185110228 22:48896460-48896482 GGGCAGGGGTGGGAGGTGATGGG + Intergenic
1185148441 22:49151497-49151519 TGGCAAGGGCAGGAAGTGACAGG + Intergenic
1185211548 22:49573377-49573399 GAGCAGGGGCAGGATGTGCTGGG + Intronic
949285995 3:2405163-2405185 GAGCAGGGGCAGGAATTGTTTGG + Intronic
950455995 3:13093113-13093135 GGGCAGGGGCAGGACCTGTGTGG - Intergenic
950476865 3:13220248-13220270 GGTCTGGGGCTGGAACTGAGTGG - Intergenic
950554019 3:13684424-13684446 GGGCAGGGGCAGGTAAGGGTGGG + Intergenic
950781865 3:15399183-15399205 GGGCAGGGGAAGGAAAGGATAGG - Intronic
950818854 3:15736454-15736476 TTGCAGGGGTAGGAACTTATAGG - Intronic
950853719 3:16086616-16086638 GGGAAGGTGCAGGAAGGGATTGG + Intergenic
951106055 3:18744408-18744430 GGGAAGAGGCAGCAAGTGATTGG + Intergenic
953071017 3:39519790-39519812 GGGCTGGGGCAGGAGCAGTTAGG + Intronic
953090441 3:39719369-39719391 TGGTGGGGGCAGGAACTGAGAGG - Intergenic
953780838 3:45869128-45869150 GTGCATGGGCAGGAAGGGATGGG + Intronic
954398174 3:50303804-50303826 GGGCAGGGGCAGACCCTGCTGGG + Intronic
954758127 3:52853656-52853678 GGGCTGGGGCAGGACCTGGTGGG - Intronic
954873677 3:53786724-53786746 GGGCAGGGGCAGGGGCAGAGTGG - Intronic
956153522 3:66268738-66268760 TGGCAGGGGAGGGACCTGATGGG + Intronic
958668290 3:97168892-97168914 GGGCAGGGGTTGGAACAGCTTGG + Intronic
960550952 3:118975869-118975891 GGGCAGGGGGAGGAAGTCAAGGG + Intronic
961632111 3:128308707-128308729 GAGGAGGGGCAGGAACAGAAGGG - Intronic
961644950 3:128387923-128387945 GGGCACGGGCAGGCACTGGATGG + Intronic
961653888 3:128430935-128430957 GGGCAGGGGCAGGAGCAGTGGGG + Intergenic
962270794 3:133976722-133976744 GGGCAGGGGCATGTCATGATGGG - Intronic
962894075 3:139698409-139698431 GGGCAGGGGCAGGGTCTCTTTGG + Intergenic
963287982 3:143455088-143455110 GGGGAGGGGCAGAAAATGCTGGG + Intronic
963707017 3:148699518-148699540 GTGCAGGGGCAGGAAAGCATGGG + Intronic
964302980 3:155309874-155309896 GGGCCGGGGCCGGAGCCGATGGG + Intergenic
966687170 3:182708751-182708773 CTTCAGGGGCAGGAACTGAGAGG - Intergenic
967709450 3:192688098-192688120 GGGCTGGGGCAGAAAGTGATGGG - Intronic
968127894 3:196173729-196173751 GGCCAGGGGCACGTACGGATCGG + Intergenic
968319514 3:197752260-197752282 TGGCAGAGGCAGGACCTGAAAGG - Intronic
968412764 4:404042-404064 GAGCAGGGGGCGGCACTGATTGG + Intergenic
968843967 4:3029527-3029549 GGGCAGGGGCAGGGCCTGGGAGG - Intronic
969118237 4:4887867-4887889 GTCCAGGGGCAGGAAATGAATGG - Intergenic
969283798 4:6189993-6190015 GGGCAGGGGAATGGACTAATGGG - Intronic
969495438 4:7523624-7523646 GAGCCGGGGCAGCAACTGAATGG + Intronic
969530907 4:7729648-7729670 GGGCAGGAGCACGTACAGATCGG - Exonic
969531674 4:7734027-7734049 GGGGACGGGCAGGAACAGGTGGG + Intronic
970659337 4:18266264-18266286 GGGCAGAGGCTGGAACAGTTTGG - Intergenic
972749263 4:41972477-41972499 AGGCAGAGGCTGGAACTGTTTGG + Intergenic
974806013 4:66882101-66882123 GGGCAGAGGTTGGAACTGTTTGG + Intergenic
976134590 4:81922053-81922075 GGGCACTGGCAGCAAGTGATAGG - Intronic
976392217 4:84517456-84517478 GGGGAGGGGAAAGAACAGATGGG - Intergenic
976952310 4:90849136-90849158 AGGCAGAGGTAGGAACTGTTTGG + Intronic
977145029 4:93429051-93429073 GGGCACGGGCAGCAACTTTTTGG - Intronic
978839671 4:113196413-113196435 GGGCTGGTGCAGGAGCTGCTGGG + Exonic
979037958 4:115749620-115749642 TAGCAAGGGCAGAAACTGATAGG - Intergenic
979059443 4:116038412-116038434 GGCCAGGGGGAGGGAATGATGGG + Intergenic
979400086 4:120238544-120238566 GGACAAGGTCAGGAACTGCTGGG + Intergenic
981038526 4:140197212-140197234 GTCCAGGGTCAGGAACTGATTGG - Intergenic
981356963 4:143799971-143799993 GGGAAGAGGCTGGAACAGATTGG - Intergenic
981368495 4:143930569-143930591 GGGCAGAGGCTGGAACAGATTGG - Intergenic
981378291 4:144040856-144040878 GGGTAGAGGCTGGAACAGATTGG - Intergenic
981430608 4:144654661-144654683 GGGCAGGGGCAGGGAAGGGTGGG - Intronic
982505039 4:156206386-156206408 AGGCAGAGGATGGAACTGATTGG - Intergenic
983141415 4:164154607-164154629 GGGCAGGTGCAGGAAATGAGGGG + Intronic
983402571 4:167284098-167284120 AGCCAGGGGCAGGAACTCAGAGG - Intergenic
983494494 4:168427960-168427982 TTGCAGGGCCAGGAACTGATGGG - Intronic
983553438 4:169038848-169038870 GGGGAGGGGCAGGTACTCCTGGG + Intergenic
985579928 5:691287-691309 GGGAAGGGGCAGGAAGTGGAGGG - Intronic
985592685 5:773730-773752 GGGCCTGGCCAGGAACTGCTTGG + Intergenic
985594775 5:783346-783368 GGGAAGGGGCAGGAAGTGGAGGG - Intergenic
985953086 5:3238117-3238139 GGTCAGGGTCCGGAACTGGTAGG - Intergenic
986081204 5:4395868-4395890 AGGCAGAGGCAGGAACAGTTTGG - Intergenic
986740263 5:10699741-10699763 GGGCAGGGGCAGGAAGCAAGGGG + Intronic
988009107 5:25461013-25461035 GGGCAGAGGCTGGAACAGTTTGG + Intergenic
988083793 5:26446826-26446848 TGTCAGGGGCAGGACCTGATGGG - Intergenic
988796524 5:34657075-34657097 GGGCAGGGGCAGGCCCAGAGGGG - Intronic
990319034 5:54611750-54611772 GGGTGGGGGCTGGAAATGATGGG + Intergenic
991075405 5:62531015-62531037 GGGCAGAGGGAGGAACTCAAAGG - Intronic
993124937 5:83822378-83822400 TGGCAGGGGCAGGGGATGATTGG - Intergenic
993302010 5:86223516-86223538 GGATAGGGGCAGGAAGTGCTAGG + Intergenic
993746084 5:91598672-91598694 AGGCATGGGCAGCAACTAATTGG + Intergenic
996011360 5:118484426-118484448 AGGCAGAGGCTGGAACTGTTTGG - Intergenic
997329960 5:133052625-133052647 GGGCACGGGTAGGAACTGGAAGG + Intronic
997369418 5:133348567-133348589 GGCCAGGTGCAGGAGCTGAGGGG + Intronic
997694293 5:135849468-135849490 GACCAGGGGCAGGAGCTGACAGG - Intronic
997695255 5:135856453-135856475 GGGCTGGGGCAGGAGATGCTAGG - Intronic
998139450 5:139691593-139691615 GGGCTGGGGAAAGAACTGTTAGG + Intergenic
998797997 5:145839231-145839253 ATGCAGGGGCAGAAACTGAGTGG + Intergenic
999285377 5:150391430-150391452 GGGCTGGAGCAGGGACTGAGGGG - Intronic
999661781 5:153871905-153871927 GGGCAGGAGGAGGAACAGCTAGG - Intergenic
1000089450 5:157917623-157917645 GGGCAGAGGCATGAATGGATGGG - Intergenic
1000112985 5:158126997-158127019 GGGTGGGGGCAGGAACTGGGGGG - Intergenic
1002299559 5:178249423-178249445 GGGCAGGGGCCGGGGCAGATGGG + Intronic
1002301462 5:178259641-178259663 GGGCAGGGGCTGGGACGGAATGG - Intronic
1002421224 5:179150115-179150137 GAGCAGGAGCAGGAGCTGGTGGG - Intronic
1002570239 5:180136017-180136039 GGGCAGGGGCAGGAGGGGGTAGG + Intronic
1002699037 5:181109708-181109730 GGGCAGAGGGAGGAGCTGAGCGG + Intergenic
1002860498 6:1075477-1075499 GGGCAGGTGCAGGAGCTGGAAGG - Intergenic
1003033580 6:2623594-2623616 GAGATGGGGCAGGAACTGAGGGG + Exonic
1003723595 6:8733756-8733778 GGCGTGGGGCAGGAGCTGATGGG + Intergenic
1006068201 6:31477742-31477764 GTGGAGGGGCAGGAGCTGAGTGG - Intergenic
1006673245 6:35743085-35743107 AGGGAAGGGCAGGTACTGATGGG + Intronic
1006922807 6:37637507-37637529 TGGCAGGGGCAGGAAGTGGCAGG + Intronic
1007257323 6:40538196-40538218 GGGGAGGGGCAGGAAGTGAGGGG + Intronic
1007278568 6:40693349-40693371 GGGCAGGGGCAGGGCCTGCTGGG + Intergenic
1007522186 6:42459379-42459401 GGGCAGGTGCAGGAAGTTTTAGG - Intergenic
1007705364 6:43787528-43787550 GGGCAGGGGCAGGGAGTGGGTGG + Intergenic
1011807779 6:91092138-91092160 AGCCAGGGGAAGGAAGTGATGGG + Intergenic
1013188719 6:107783956-107783978 GGGCAGGGGCAGGAGGTGGCAGG - Intronic
1013845668 6:114447936-114447958 TGGCAGGGGCAGAACCTGGTGGG - Intergenic
1016094045 6:140014408-140014430 GAGCCAGGGAAGGAACTGATTGG - Intergenic
1016162337 6:140897556-140897578 GGGCATGGCCAGTAACTGCTTGG - Intergenic
1016566746 6:145463922-145463944 TGGCAGGGGAAGGACCTGGTGGG + Intergenic
1016579615 6:145615568-145615590 AGGCAGGGGCTGGAACAGTTTGG + Intronic
1017580240 6:155856983-155857005 GGGCATGGGGAGGAGCTGAAGGG - Intergenic
1018034117 6:159866992-159867014 GGGCAGGGGCAGGAAGCGTTAGG - Intergenic
1018158529 6:161013816-161013838 GGGAAGGGGTAGTAACTGCTGGG + Intronic
1018936035 6:168274509-168274531 CGGCTGGGGCAGGTCCTGATGGG + Intergenic
1020222065 7:6246659-6246681 GGGGTGGGGCAGGGACTGTTAGG - Intronic
1020498249 7:8883894-8883916 GGACAGGGGCAGGGACTGTATGG + Intergenic
1020577667 7:9954915-9954937 GTGCTGGGGCAGGAAGTGAGGGG + Intergenic
1021253071 7:18355902-18355924 GGGCTGGGGCAGGAATGGGTGGG + Intronic
1022445161 7:30464343-30464365 GGGCAGGGGCAGAGAGTGGTGGG + Intronic
1022501510 7:30884923-30884945 GGGCAGGGGAAGGAAGTTTTGGG - Intronic
1022532679 7:31076776-31076798 GGGGAGGGGCAGGAACAGGCTGG - Intronic
1023779989 7:43646641-43646663 GGACAGGGGCAGGACATGAGAGG - Intronic
1024598407 7:50959562-50959584 GAGCAGGGGCAGGAGCAGACTGG - Intergenic
1024806449 7:53147366-53147388 GGGAAGGGGCAGTAACTTTTGGG + Intergenic
1024880567 7:54081131-54081153 GGGCAGGGGCAGGAGATCAGGGG - Intergenic
1025282461 7:57638172-57638194 GTTCAGGGACAGGAACTGGTGGG + Intergenic
1025302262 7:57827235-57827257 GTTCAGGGACAGGAACTGGTGGG - Intergenic
1026376967 7:69761556-69761578 GTGCAGGGTCAGGGACTGAGGGG + Intronic
1026586470 7:71660094-71660116 GGGCAGGGGGATGAAATGAGAGG - Intronic
1027888364 7:83938084-83938106 GGGCAGGTGCAGGAACCAAGGGG - Intergenic
1028584213 7:92437263-92437285 GGGCAGGTGCTGGGACTGAGAGG + Intergenic
1030463800 7:109874512-109874534 GTGCAGGGGCAGGAAGTGGATGG + Intergenic
1030784845 7:113646481-113646503 AGGCAGAGGCGGGAACTGTTTGG - Intergenic
1031906921 7:127470571-127470593 GGGCAAGGGAAGGAAGGGATAGG + Intergenic
1031908334 7:127486669-127486691 GGGCAGGGGAAGTAACTAAGTGG + Intergenic
1032012742 7:128357530-128357552 CAGCAGGGGCAGGATGTGATTGG - Intronic
1034212258 7:149374148-149374170 GGGCAGAGGCTGGAACAGTTTGG - Intergenic
1034558899 7:151867168-151867190 GGGCAGGGGCTTGCACTGAGGGG - Intronic
1035224313 7:157425101-157425123 GGGCAGGGGGAGGCAGTGAAGGG + Intergenic
1035339442 7:158151101-158151123 GGGCAGGGGTAGGAGCAGAAAGG - Intronic
1036026564 8:4915571-4915593 GGGCAGGAGCAGGGACAGCTGGG + Intronic
1036717426 8:11139363-11139385 GTGCAGGGGCAGTGACTGCTGGG - Intronic
1037804770 8:22053180-22053202 GAGAAGTGGCAGGAAGTGATTGG + Intronic
1038241150 8:25808909-25808931 GGGCAGGGGAGGGAAATGAGAGG + Intergenic
1038710388 8:29938623-29938645 GGGCAGGGGTGGCAACTGAGAGG - Intergenic
1039489284 8:37935671-37935693 GGGCTGGAGCAGGAAGGGATGGG - Intronic
1042424531 8:68632038-68632060 GGGCAGTGGCTGGAACAGTTTGG + Intronic
1044225709 8:89716154-89716176 TGGCAGGGGTAAGAACTGCTGGG - Intergenic
1044326810 8:90868356-90868378 GGGCAGAGGTTGGAACTGTTTGG + Intronic
1045617992 8:103940035-103940057 GGGCAGGGGTTGGAACAGTTTGG - Intronic
1045829757 8:106444696-106444718 GGTGAGGGGCAGGAACTTAGAGG + Intronic
1045947562 8:107813854-107813876 AGGCAGGGACAGGAAGTGACAGG - Intergenic
1046607489 8:116388015-116388037 GGGCAGAGGTAGGAACAGTTTGG + Intergenic
1048473754 8:134725027-134725049 GAGCAGGGGTAGGAGCAGATGGG - Intergenic
1049701919 8:144019064-144019086 GGGACGGGGAAGGAACTGAGAGG + Intronic
1049725505 8:144143836-144143858 CGGCAGAGGCAGGGAGTGATGGG + Intergenic
1049749836 8:144277820-144277842 GGGCAGGGGCGGCCACTGCTGGG + Intronic
1053289094 9:36868336-36868358 AGGCAGGGCCAGGATCTGAGAGG + Intronic
1053294627 9:36903801-36903823 GTGTAGGGGCCGGGACTGATGGG - Intronic
1053434673 9:38067266-38067288 GCGCAGCGGGAGGAACTGACGGG + Intronic
1053876819 9:42553735-42553757 GGGGAGGGACAGGAGCAGATAGG - Intergenic
1053895857 9:42740970-42740992 GGGGAGGGACAGGAGCAGATAGG + Intergenic
1054234878 9:62547987-62548009 GGGGAGGGACAGGAGCAGATAGG + Intergenic
1056871718 9:90288023-90288045 TGGCTGGGGCAGGCTCTGATGGG - Intergenic
1057096293 9:92313040-92313062 TGGCAGGGGAAGGGAGTGATAGG - Intronic
1057129250 9:92641782-92641804 AGGCAGGGGCACGAAATGAATGG + Intronic
1057211315 9:93202519-93202541 TGGGAGGGGCGGGAACTGCTGGG + Intronic
1057551906 9:96057280-96057302 GGGCAGGGGCAGGACCTGGCTGG + Intergenic
1057559746 9:96117904-96117926 GGGCTGGGGCAGGAGCTGCTGGG + Intergenic
1058174432 9:101721505-101721527 GGGCAGAGGCTGGAACAGTTTGG + Intronic
1059106444 9:111515890-111515912 GGGCAGGGGCAGAAAGGGACTGG - Intergenic
1060824020 9:126677265-126677287 GGGCAGGAGCAGGAATTAAAAGG - Intronic
1061329621 9:129884493-129884515 GAGCAGGGACAGGAAGTGCTCGG + Intergenic
1061625213 9:131837385-131837407 GGGCAGGGGCAGGGATTGGCAGG + Intergenic
1061754807 9:132804879-132804901 AGGCAGGGGCAGGACATGAGGGG - Intronic
1062113782 9:134796783-134796805 GGTCAGCGGCAGGAGCTGCTCGG + Intronic
1062395804 9:136352338-136352360 GGGGAGGGGCAGGGGCTGGTTGG - Intronic
1062502539 9:136857598-136857620 TGGCAGGGGCAGGGATTGAGGGG + Intronic
1186568451 X:10689444-10689466 TGTCAGGGGAGGGAACTGATGGG - Intronic
1187082595 X:16006877-16006899 AGCCAGGGGCTGGAACAGATGGG + Intergenic
1187639761 X:21274973-21274995 GGGCAGAGGCTGGAACAGTTTGG - Intergenic
1187697497 X:21936894-21936916 GGGCAGGTGAGGGAGCTGATGGG - Intergenic
1187757043 X:22539460-22539482 GGGCTGTGGTAGGAAGTGATTGG + Intergenic
1187824734 X:23323645-23323667 GAGGAGGGGGAGGAAATGATTGG - Intergenic
1189714950 X:43855795-43855817 GGGAAGGAGCAGGAAGGGATAGG + Intronic
1191920677 X:66253930-66253952 GGGGTGGGGCAGGAATGGATGGG + Intronic
1192183341 X:68929801-68929823 GAGCAGGGACAGGAGCTGAGGGG + Intergenic
1193140149 X:78018596-78018618 GGGCAGAGGCTGGAACAGTTTGG - Intronic
1193489784 X:82134803-82134825 GGGCAGAGGTTGGAACTGTTTGG - Intergenic
1195067990 X:101254756-101254778 GGACATGGGCAAGAGCTGATGGG - Intronic
1195114516 X:101683338-101683360 GGGCAGGAGCGGGAACTCACAGG + Intergenic
1195287022 X:103395654-103395676 GGGCAGGAGCTGGAACTAACAGG - Intergenic
1197075273 X:122345475-122345497 GGGCAGAGGCTGGAACAGTTTGG - Intergenic
1197303777 X:124814774-124814796 AGGGAGGGGCAGGATATGATTGG + Intronic
1198065999 X:133097302-133097324 GTGCAGTGGCAGGAACTGTGGGG + Intergenic
1199274917 X:145929374-145929396 AGGCAGAGGCTGGAACTGTTTGG + Intergenic
1199608454 X:149594559-149594581 AGGCAGGGGAAGGATCTGCTGGG + Exonic
1199630666 X:149774801-149774823 AGGCAGGGGAAGGATCTGCTGGG - Exonic
1200101066 X:153689254-153689276 GGGCAGGGGGAGGGACAGAGTGG - Intronic
1201152453 Y:11101521-11101543 GGGCTAGCGCAGGAGCTGATAGG + Intergenic