ID: 1162798519

View in Genome Browser
Species Human (GRCh38)
Location 19:13098808-13098830
Sequence CCGCACGGTCGCGTTAGCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162798519_1162798528 -6 Left 1162798519 19:13098808-13098830 CCTTCGCTAACGCGACCGTGCGG No data
Right 1162798528 19:13098825-13098847 GTGCGGGACTGGGTCGGGGTCGG 0: 1
1: 1
2: 0
3: 20
4: 375
1162798519_1162798526 -10 Left 1162798519 19:13098808-13098830 CCTTCGCTAACGCGACCGTGCGG No data
Right 1162798526 19:13098821-13098843 GACCGTGCGGGACTGGGTCGGGG 0: 1
1: 0
2: 0
3: 3
4: 74
1162798519_1162798530 -1 Left 1162798519 19:13098808-13098830 CCTTCGCTAACGCGACCGTGCGG No data
Right 1162798530 19:13098830-13098852 GGACTGGGTCGGGGTCGGTAGGG 0: 1
1: 0
2: 0
3: 9
4: 139
1162798519_1162798529 -2 Left 1162798519 19:13098808-13098830 CCTTCGCTAACGCGACCGTGCGG No data
Right 1162798529 19:13098829-13098851 GGGACTGGGTCGGGGTCGGTAGG 0: 1
1: 0
2: 1
3: 22
4: 296
1162798519_1162798531 15 Left 1162798519 19:13098808-13098830 CCTTCGCTAACGCGACCGTGCGG No data
Right 1162798531 19:13098846-13098868 GGTAGGGTGCGTCCCCGACTTGG 0: 1
1: 0
2: 0
3: 3
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162798519 Original CRISPR CCGCACGGTCGCGTTAGCGA AGG (reversed) Intergenic
No off target data available for this crispr