ID: 1162799036

View in Genome Browser
Species Human (GRCh38)
Location 19:13101048-13101070
Sequence TGCCTCGCCTGGGCCCCCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 229}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162799036_1162799052 10 Left 1162799036 19:13101048-13101070 CCTGCGGGGGCCCAGGCGAGGCA 0: 1
1: 0
2: 2
3: 18
4: 229
Right 1162799052 19:13101081-13101103 GTGGGGCAGGCGCTGGGCTGGGG 0: 1
1: 0
2: 9
3: 138
4: 1051
1162799036_1162799044 -9 Left 1162799036 19:13101048-13101070 CCTGCGGGGGCCCAGGCGAGGCA 0: 1
1: 0
2: 2
3: 18
4: 229
Right 1162799044 19:13101062-13101084 GGCGAGGCAGGCTTAGGGGGTGG 0: 1
1: 0
2: 1
3: 32
4: 312
1162799036_1162799046 -7 Left 1162799036 19:13101048-13101070 CCTGCGGGGGCCCAGGCGAGGCA 0: 1
1: 0
2: 2
3: 18
4: 229
Right 1162799046 19:13101064-13101086 CGAGGCAGGCTTAGGGGGTGGGG 0: 1
1: 0
2: 0
3: 20
4: 306
1162799036_1162799049 4 Left 1162799036 19:13101048-13101070 CCTGCGGGGGCCCAGGCGAGGCA 0: 1
1: 0
2: 2
3: 18
4: 229
Right 1162799049 19:13101075-13101097 TAGGGGGTGGGGCAGGCGCTGGG 0: 1
1: 0
2: 3
3: 63
4: 607
1162799036_1162799051 9 Left 1162799036 19:13101048-13101070 CCTGCGGGGGCCCAGGCGAGGCA 0: 1
1: 0
2: 2
3: 18
4: 229
Right 1162799051 19:13101080-13101102 GGTGGGGCAGGCGCTGGGCTGGG 0: 1
1: 0
2: 7
3: 157
4: 1123
1162799036_1162799053 11 Left 1162799036 19:13101048-13101070 CCTGCGGGGGCCCAGGCGAGGCA 0: 1
1: 0
2: 2
3: 18
4: 229
Right 1162799053 19:13101082-13101104 TGGGGCAGGCGCTGGGCTGGGGG 0: 1
1: 0
2: 19
3: 118
4: 1034
1162799036_1162799045 -8 Left 1162799036 19:13101048-13101070 CCTGCGGGGGCCCAGGCGAGGCA 0: 1
1: 0
2: 2
3: 18
4: 229
Right 1162799045 19:13101063-13101085 GCGAGGCAGGCTTAGGGGGTGGG 0: 1
1: 0
2: 1
3: 20
4: 262
1162799036_1162799050 8 Left 1162799036 19:13101048-13101070 CCTGCGGGGGCCCAGGCGAGGCA 0: 1
1: 0
2: 2
3: 18
4: 229
Right 1162799050 19:13101079-13101101 GGGTGGGGCAGGCGCTGGGCTGG 0: 1
1: 1
2: 17
3: 226
4: 1453
1162799036_1162799047 -3 Left 1162799036 19:13101048-13101070 CCTGCGGGGGCCCAGGCGAGGCA 0: 1
1: 0
2: 2
3: 18
4: 229
Right 1162799047 19:13101068-13101090 GCAGGCTTAGGGGGTGGGGCAGG 0: 1
1: 0
2: 2
3: 66
4: 706
1162799036_1162799048 3 Left 1162799036 19:13101048-13101070 CCTGCGGGGGCCCAGGCGAGGCA 0: 1
1: 0
2: 2
3: 18
4: 229
Right 1162799048 19:13101074-13101096 TTAGGGGGTGGGGCAGGCGCTGG 0: 1
1: 0
2: 0
3: 37
4: 531

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162799036 Original CRISPR TGCCTCGCCTGGGCCCCCGC AGG (reversed) Exonic