ID: 1162799398

View in Genome Browser
Species Human (GRCh38)
Location 19:13102678-13102700
Sequence CCGCGCCTCCTCGTGGGCCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162799386_1162799398 9 Left 1162799386 19:13102646-13102668 CCGGCCTCAATGCTCCAGGCCCC 0: 1
1: 0
2: 2
3: 34
4: 318
Right 1162799398 19:13102678-13102700 CCGCGCCTCCTCGTGGGCCTCGG 0: 1
1: 0
2: 0
3: 13
4: 150
1162799391_1162799398 -5 Left 1162799391 19:13102660-13102682 CCAGGCCCCGGCGTTGGGCCGCG 0: 1
1: 0
2: 2
3: 13
4: 150
Right 1162799398 19:13102678-13102700 CCGCGCCTCCTCGTGGGCCTCGG 0: 1
1: 0
2: 0
3: 13
4: 150
1162799388_1162799398 5 Left 1162799388 19:13102650-13102672 CCTCAATGCTCCAGGCCCCGGCG 0: 1
1: 0
2: 0
3: 16
4: 134
Right 1162799398 19:13102678-13102700 CCGCGCCTCCTCGTGGGCCTCGG 0: 1
1: 0
2: 0
3: 13
4: 150
1162799392_1162799398 -10 Left 1162799392 19:13102665-13102687 CCCCGGCGTTGGGCCGCGCCTCC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1162799398 19:13102678-13102700 CCGCGCCTCCTCGTGGGCCTCGG 0: 1
1: 0
2: 0
3: 13
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162799398 Original CRISPR CCGCGCCTCCTCGTGGGCCT CGG Exonic
902801071 1:18830645-18830667 GCGCCCCTCCTCGTCGGCCCAGG + Intergenic
903777153 1:25800388-25800410 CCGCGCGGCCGCCTGGGCCTCGG - Exonic
903969952 1:27112236-27112258 CCACGCCTCCTCATGGGGCTGGG - Intronic
908319694 1:62967426-62967448 CCACGCCCCCATGTGGGCCTGGG - Intergenic
908714295 1:67053767-67053789 CCGCTCCTCCTCCGCGGCCTGGG + Intronic
913045294 1:115068947-115068969 CAGCTCCTCCTGGTGGGGCTTGG - Intronic
914377042 1:147080656-147080678 TCGCTCCTCCTGGAGGGCCTGGG + Intergenic
914474693 1:148013642-148013664 TCGCTCCTCCTGGAGGGCCTGGG - Intergenic
917310128 1:173669871-173669893 CAGCGCCTCCTCCTGCGCCGCGG + Intergenic
1066656073 10:37700991-37701013 CAGCCCCTTCACGTGGGCCTCGG - Intergenic
1067110637 10:43397201-43397223 CCGCGCCTCCTCGGGGCCGACGG - Intronic
1067575169 10:47404234-47404256 CAGTGCCTCCTGCTGGGCCTGGG - Intergenic
1067711884 10:48656425-48656447 CGGCGCCCCCTGGCGGGCCTCGG + Intergenic
1070314243 10:75295249-75295271 GCGCGCCCCCTCATGGGCCCCGG + Intergenic
1070924181 10:80207324-80207346 CCGCGCCTGCTGGTGGGGGTAGG - Intergenic
1073100315 10:101002955-101002977 CGGCTCTTCCTTGTGGGCCTGGG + Intronic
1073491607 10:103856135-103856157 CATCTCCTCCTCGGGGGCCTGGG - Intergenic
1075631379 10:124002636-124002658 CCCAGCCTCCTCTTGGGGCTTGG + Intergenic
1075722949 10:124597992-124598014 CCCCGGCTCCTGGTGGGCCCTGG + Intronic
1076140850 10:128077618-128077640 CTGCTCCTCCTGGCGGGCCTGGG - Exonic
1076685978 10:132198674-132198696 CCACGCCACCTTCTGGGCCTCGG - Intronic
1077278989 11:1733447-1733469 CAGCACCTGCCCGTGGGCCTGGG - Exonic
1077327530 11:1970146-1970168 TCGCCCCTCCTCGAGGGGCTGGG + Intronic
1077330178 11:1980722-1980744 CCACCCCTCCCCGTGGACCTAGG + Intronic
1077423947 11:2465806-2465828 CCACGGCTCCCCTTGGGCCTTGG + Intronic
1078414117 11:11151101-11151123 AAGCCCCTCCTCTTGGGCCTTGG - Intergenic
1083182602 11:60996788-60996810 CCTGACCTCCCCGTGGGCCTTGG + Intronic
1083227733 11:61295205-61295227 CCGCGTCCCCTCGCGGCCCTCGG - Exonic
1083970410 11:66070737-66070759 CCGCGCCTCCCGGTGGCCCGGGG + Exonic
1084035948 11:66510530-66510552 CAGCGCGTCCTCCTGAGCCTGGG + Intronic
1087046871 11:93850241-93850263 CGCCGCTTCCTCGTGGGGCTGGG - Intronic
1202810512 11_KI270721v1_random:25326-25348 TCGCCCCTCCTCGAGGGGCTGGG + Intergenic
1202813155 11_KI270721v1_random:35901-35923 CCACCCCTCCCCGTGGACCTAGG + Intergenic
1092932850 12:13333444-13333466 CCGTGCCCCCTCATGGACCTTGG + Intergenic
1094830331 12:34297270-34297292 CCTGGCGTCCTCGGGGGCCTTGG + Intergenic
1099729731 12:86484819-86484841 CCAAGCCTGCTCTTGGGCCTTGG - Intronic
1102487127 12:113266112-113266134 CCGCGGCTCCTCTTTGGCGTTGG + Intronic
1103091855 12:118103622-118103644 CCCCGCGTCCTCGTCTGCCTCGG - Exonic
1104708368 12:130966588-130966610 CCACGCCTCCTGATGGCCCTGGG - Intronic
1106809978 13:33350088-33350110 CCGCGCCTCCCGGTGGGTGTGGG - Intronic
1112216147 13:97433692-97433714 TCGCGGCCCCTCTTGGGCCTTGG + Intergenic
1112567078 13:100560943-100560965 CCGCATCTCCTCCAGGGCCTGGG + Intronic
1113868962 13:113546422-113546444 CGGCCCCTCCTCCTGGGTCTGGG - Intronic
1114522201 14:23346853-23346875 CAGCGCCTCCACATGGGCCATGG - Exonic
1119106847 14:71932684-71932706 CCGCGCGTCCTCGCGGGCCCGGG + Exonic
1123036916 14:105475286-105475308 CCGCGCGCTCCCGTGGGCCTGGG + Intronic
1130997767 15:88913246-88913268 CCCAGCCTCCTCGTCGCCCTGGG - Exonic
1131828634 15:96340718-96340740 CCCCTCCTCCTCGTGGCGCTCGG + Intergenic
1132764644 16:1528054-1528076 CCAGGCCTCCTGGTGGGGCTGGG + Intronic
1133103891 16:3494727-3494749 CTGCGCCACCTCCGGGGCCTGGG - Exonic
1136251573 16:29008922-29008944 CCTCGCCCCCTCGTGTACCTGGG + Intergenic
1139775728 16:69316051-69316073 CAGCGCCTCCTCGTAGTTCTTGG - Exonic
1140221730 16:73048517-73048539 CAGCGCCTCCGGGAGGGCCTGGG - Intronic
1140723682 16:77792740-77792762 CCACGCCTTCTGGTTGGCCTTGG + Intronic
1141630323 16:85284141-85284163 CCGGGCCTTCTCCTGGGCCGGGG - Intergenic
1142222647 16:88863229-88863251 CCGCGTCTCCCCGTGGGACGGGG - Intergenic
1143521529 17:7446955-7446977 CCGCGCCACCTCCCGGGCTTTGG - Intronic
1144756156 17:17681763-17681785 CCGCGCTCACTCGGGGGCCTTGG - Exonic
1144873354 17:18383487-18383509 CAGGGCCTCCTGGTGGGCCTGGG - Exonic
1147028447 17:37609498-37609520 CCACGCCTCCCCGAGGGCCGGGG - Intergenic
1147705369 17:42422034-42422056 CCGCGCCCCCACATCGGCCTCGG - Intronic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148262247 17:46193564-46193586 CCGCGCCTCCTGGCGGCCCGCGG - Intronic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1151747887 17:76021546-76021568 CAGGGCCTCCTGGTGGGCCTGGG + Exonic
1152621517 17:81367222-81367244 CCGCTCCTCGTTGTGGGCCCTGG - Intergenic
1152683803 17:81683924-81683946 CCCCGCCTCCTCGCGGCTCTAGG + Exonic
1152747791 17:82049221-82049243 CCTGGCCTCCCCGAGGGCCTGGG - Intronic
1153474965 18:5489112-5489134 CCCCGCCGCCTCCTGGGGCTCGG + Exonic
1153999618 18:10472462-10472484 CCCCGCCTCCTCCAGGGCCTGGG - Intronic
1157281984 18:46352170-46352192 CCCCTCCTCCTTGGGGGCCTTGG + Intronic
1157284960 18:46371378-46371400 CAGAGCCTCCTCGCTGGCCTGGG - Intronic
1158976630 18:62716154-62716176 CCCCGCCTCCTGCTCGGCCTCGG + Exonic
1159954246 18:74508109-74508131 CGTGGCCTTCTCGTGGGCCTGGG - Intronic
1160552565 18:79704385-79704407 ACGCCCCTCCACGTGGGCATGGG - Intronic
1160817969 19:1044922-1044944 CCGCTCCTCCCCCTGGACCTCGG - Intronic
1161579823 19:5074744-5074766 TCCCGCCTCCCCGTGCGCCTGGG + Intronic
1162238165 19:9324440-9324462 CCCCGCCTCCTCCCGGGCCGAGG - Intronic
1162741773 19:12777727-12777749 CCGCGCCCCCTGGTGGGCCCGGG - Intronic
1162744123 19:12789695-12789717 CCCCGCCTGCCCGCGGGCCTGGG - Intronic
1162799398 19:13102678-13102700 CCGCGCCTCCTCGTGGGCCTCGG + Exonic
1163325380 19:16600096-16600118 CCTGGGCTCCTGGTGGGCCTGGG - Intronic
1163641605 19:18465455-18465477 CCGCGTCTCCTCCTCCGCCTGGG + Exonic
1165129425 19:33622600-33622622 CCGCTCCGCCTCCTGGCCCTCGG + Intronic
1165907472 19:39202882-39202904 ACGCTCCTCCTCCTGGGTCTTGG + Exonic
1165922604 19:39308125-39308147 CAGCGCCTCGTAGTGGTCCTGGG + Exonic
1167377583 19:49119932-49119954 TCGCGCCTCCTCCAGGGCCCAGG + Intronic
1167483118 19:49745313-49745335 CTGCGGCTGCTCGGGGGCCTGGG - Exonic
1167960774 19:53102963-53102985 CCGCGCCTCCGCCTGGTCCTGGG - Intronic
1167971885 19:53192912-53192934 CCGCGCCTCTGCCTGGTCCTGGG - Intronic
926027331 2:9556196-9556218 TCGCGCCTCCTCGTCCGCCCTGG - Intergenic
926705722 2:15836056-15836078 CCGCACGTGCTCTTGGGCCTGGG + Intergenic
928201122 2:29248107-29248129 CCTCACCTCCTCCTTGGCCTTGG - Intronic
929974314 2:46617037-46617059 CTGCGCCTGCGCGTGGGCCTGGG - Exonic
937095651 2:119233768-119233790 CCTGGCCTCCACCTGGGCCTAGG - Intronic
941905499 2:170714376-170714398 CCGGGCCTCCTGGGTGGCCTGGG + Exonic
947595586 2:231409690-231409712 CTGGGCCTCCACCTGGGCCTGGG - Intergenic
947803803 2:232950637-232950659 CAAAGCCTCCTCTTGGGCCTTGG + Intronic
948624675 2:239261723-239261745 CCCTTCCTCCCCGTGGGCCTGGG - Intronic
1169074412 20:2752273-2752295 CCGCGCCTCCCCGCCGTCCTCGG + Intronic
1170756828 20:19212544-19212566 CCGCTCCTCCTCGCGCGCCATGG - Intergenic
1172510524 20:35497826-35497848 GCGAGCCTCCTTGTGGGCCCAGG + Exonic
1176014870 20:62925980-62926002 CGGCGCTTCCTCCCGGGCCTTGG - Intronic
1176099775 20:63359659-63359681 CCGCTCCTCGGCGTGGGCCCGGG + Exonic
1176135607 20:63520867-63520889 CGGCGACCCCTCGCGGGCCTCGG - Exonic
1179101104 21:38356201-38356223 TAGCGCCACCTCGTGGGCCGTGG + Intergenic
1183779470 22:39989522-39989544 CCTCTCCTCCCAGTGGGCCTGGG + Intergenic
1184257218 22:43294200-43294222 CCTCCCCTCCTCGGGGGCCGGGG - Intronic
950528259 3:13537163-13537185 CCGTGGCTCCCTGTGGGCCTCGG - Intergenic
954382583 3:50227488-50227510 CGGCGCCTCCTGGCGGGCCTGGG - Intronic
954912805 3:54122737-54122759 CCGCGCGTCCCGGGGGGCCTCGG + Exonic
958762937 3:98329588-98329610 CCAGGTCTGCTCGTGGGCCTTGG - Intergenic
961402095 3:126654823-126654845 GCGCAGCTCCTCGCGGGCCTCGG + Intronic
961445315 3:126977910-126977932 CAGCGGCTCCCTGTGGGCCTAGG + Intergenic
967255851 3:187591223-187591245 CTGCCCCTCCCCCTGGGCCTTGG - Intergenic
968659725 4:1793988-1794010 CGGCGCCTCCTCGGAGTCCTTGG + Exonic
969225993 4:5798668-5798690 CTGCCCCACCTCCTGGGCCTCGG - Exonic
969271387 4:6105674-6105696 GCGCGCCTCCTCGCGCGCCTCGG + Exonic
973981862 4:56314476-56314498 CCTCTCCTCCGCTTGGGCCTGGG - Exonic
983576816 4:169270265-169270287 CCGCGCCTCCCTGCGGGCTTGGG - Intronic
985681205 5:1256866-1256888 CCGCGCCTCCACACGGGCTTGGG - Intronic
995388417 5:111612655-111612677 TGGCGCCTCCTAGAGGGCCTCGG - Intergenic
995725970 5:115180364-115180386 CCCCGCCTCCTCGGGGGTCGCGG + Intronic
997521377 5:134526331-134526353 CCGCGCCCCCTCGCCGGCCCGGG - Intronic
998148321 5:139743108-139743130 CCTTTCCTCCTCCTGGGCCTAGG + Intergenic
999203927 5:149835003-149835025 CCGTTCCTCCTTCTGGGCCTCGG + Intronic
999272184 5:150302935-150302957 CCGCCCCTCCACCTGGGGCTCGG - Exonic
1000082203 5:157858883-157858905 CCCCTCCCCCACGTGGGCCTCGG + Intronic
1002497020 5:179622799-179622821 CCGCCCGTCCTCCTGGCCCTTGG - Intronic
1003139011 6:3456285-3456307 CTGCCCTTCCTCGGGGGCCTGGG - Exonic
1003639198 6:7862460-7862482 CCGCGCCACGTCCTGGGACTGGG - Exonic
1004194184 6:13488611-13488633 CAGTGCCCCCTCGAGGGCCTGGG - Intergenic
1011553880 6:88554822-88554844 CAGAGCCGCCTCGTGGGCCCTGG - Intergenic
1018684435 6:166292710-166292732 CATGGCCGCCTCGTGGGCCTCGG + Intergenic
1019178785 6:170174857-170174879 CCAGGCCTCCTCCTGGGCTTTGG + Intergenic
1020117974 7:5487058-5487080 CAGCGCCACCTGCTGGGCCTTGG + Intronic
1020210602 7:6155184-6155206 CCGCGACTCCAGGTGAGCCTGGG + Exonic
1022083875 7:27048199-27048221 GCACGCCTCCTCCTGAGCCTCGG - Intergenic
1022363280 7:29684713-29684735 CCGCGGCTGCACGTGGGCCGTGG - Intergenic
1022428046 7:30285864-30285886 CCGCGGCTGCACGTGGGCCGTGG + Intronic
1022698106 7:32729047-32729069 CCGCGGCTGCACGTGGGCCGTGG + Intergenic
1022989629 7:35694934-35694956 CCGCGCCTCCTCGCGAGACCCGG - Exonic
1023904568 7:44513194-44513216 CAGTGCCTCCTCCTGGGCCTGGG - Exonic
1027960510 7:84940026-84940048 CGGCGCCTCCTCCGGGGCCGGGG + Intergenic
1028922222 7:96321640-96321662 CCGCTCCTCCTCGTCGGCCCTGG + Intronic
1029379771 7:100205357-100205379 ACGCGCCTCCTCTTGGAGCTGGG - Exonic
1035297720 7:157876645-157876667 CAGCGCCCCCACGTGGGGCTGGG + Intronic
1036620844 8:10423800-10423822 CAGCACCTCCTCTAGGGCCTGGG - Intronic
1036964002 8:13276368-13276390 GCGCGCCATCACGTGGGCCTTGG + Intronic
1037304893 8:17495190-17495212 CCTCGCCTCCTCGAGTGCCAGGG + Intergenic
1042785549 8:72542656-72542678 TCTCTCCTCCTTGTGGGCCTAGG - Intronic
1043472672 8:80578274-80578296 CCGCGCCTCCTCCTAGGGCCCGG + Intergenic
1045063728 8:98427835-98427857 CCAGGCCTCCTGGTGGGTCTTGG - Intronic
1049616596 8:143578277-143578299 CCGCGCCGCCGCGCGCGCCTCGG + Exonic
1055514729 9:77023211-77023233 CGGCGCCTCCGCTGGGGCCTGGG + Intergenic
1056445698 9:86664765-86664787 GCTCGCCTCTTCCTGGGCCTTGG + Intergenic
1057307475 9:93920628-93920650 CTCCTCCTCCTCGTGGGCCTGGG - Intergenic
1060665732 9:125431059-125431081 CAGCCCCTCCTCCTGGGACTAGG - Intergenic
1061003798 9:127917054-127917076 CCGCCCCTCCTCGCCGGCCCCGG - Intergenic
1061272022 9:129549217-129549239 CGGCGCCACCTCATGGGGCTAGG - Intergenic
1061498002 9:130986600-130986622 CCGTGCCTCATCCTGGGCCGGGG - Intergenic
1062376437 9:136263938-136263960 CCGCCCCTCCTGCCGGGCCTAGG + Intergenic
1062399881 9:136367626-136367648 ACGCTCGTCCTGGTGGGCCTGGG - Exonic
1188005431 X:25013305-25013327 CAGCTCCTCCTCGTCGTCCTCGG + Exonic