ID: 1162799473

View in Genome Browser
Species Human (GRCh38)
Location 19:13102901-13102923
Sequence CCCCGCCCGCTGGTTTCCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 99}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162799473_1162799484 22 Left 1162799473 19:13102901-13102923 CCGGAGGAAACCAGCGGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1162799484 19:13102946-13102968 GCCCCGCCCCCAGCCGGCGCTGG 0: 1
1: 0
2: 7
3: 93
4: 557
1162799473_1162799488 26 Left 1162799473 19:13102901-13102923 CCGGAGGAAACCAGCGGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1162799488 19:13102950-13102972 CGCCCCCAGCCGGCGCTGGCAGG 0: 1
1: 0
2: 0
3: 25
4: 226
1162799473_1162799478 0 Left 1162799473 19:13102901-13102923 CCGGAGGAAACCAGCGGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1162799478 19:13102924-13102946 ACCTAGCAGCGCGGGCCTCCCGG 0: 1
1: 0
2: 0
3: 8
4: 84
1162799473_1162799477 -8 Left 1162799473 19:13102901-13102923 CCGGAGGAAACCAGCGGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1162799477 19:13102916-13102938 GGGCGGGGACCTAGCAGCGCGGG 0: 1
1: 1
2: 2
3: 12
4: 142
1162799473_1162799481 16 Left 1162799473 19:13102901-13102923 CCGGAGGAAACCAGCGGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1162799481 19:13102940-13102962 CTCCCGGCCCCGCCCCCAGCCGG 0: 1
1: 2
2: 18
3: 120
4: 708
1162799473_1162799476 -9 Left 1162799473 19:13102901-13102923 CCGGAGGAAACCAGCGGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1162799476 19:13102915-13102937 CGGGCGGGGACCTAGCAGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162799473 Original CRISPR CCCCGCCCGCTGGTTTCCTC CGG (reversed) Intronic