ID: 1162799473

View in Genome Browser
Species Human (GRCh38)
Location 19:13102901-13102923
Sequence CCCCGCCCGCTGGTTTCCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 99}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162799473_1162799484 22 Left 1162799473 19:13102901-13102923 CCGGAGGAAACCAGCGGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1162799484 19:13102946-13102968 GCCCCGCCCCCAGCCGGCGCTGG 0: 1
1: 0
2: 7
3: 93
4: 557
1162799473_1162799488 26 Left 1162799473 19:13102901-13102923 CCGGAGGAAACCAGCGGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1162799488 19:13102950-13102972 CGCCCCCAGCCGGCGCTGGCAGG 0: 1
1: 0
2: 0
3: 25
4: 226
1162799473_1162799477 -8 Left 1162799473 19:13102901-13102923 CCGGAGGAAACCAGCGGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1162799477 19:13102916-13102938 GGGCGGGGACCTAGCAGCGCGGG 0: 1
1: 1
2: 2
3: 12
4: 142
1162799473_1162799481 16 Left 1162799473 19:13102901-13102923 CCGGAGGAAACCAGCGGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1162799481 19:13102940-13102962 CTCCCGGCCCCGCCCCCAGCCGG 0: 1
1: 2
2: 18
3: 120
4: 708
1162799473_1162799476 -9 Left 1162799473 19:13102901-13102923 CCGGAGGAAACCAGCGGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1162799476 19:13102915-13102937 CGGGCGGGGACCTAGCAGCGCGG 0: 1
1: 0
2: 0
3: 5
4: 86
1162799473_1162799478 0 Left 1162799473 19:13102901-13102923 CCGGAGGAAACCAGCGGGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 99
Right 1162799478 19:13102924-13102946 ACCTAGCAGCGCGGGCCTCCCGG 0: 1
1: 0
2: 0
3: 8
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162799473 Original CRISPR CCCCGCCCGCTGGTTTCCTC CGG (reversed) Intronic
900779204 1:4606547-4606569 GCCTGCCCGTTGGTTTCCTTGGG + Intergenic
901763255 1:11484314-11484336 CCCCGCTGGCTGGTTCTCTCTGG + Intronic
901916517 1:12504622-12504644 CCCGGCCCGCTGGCTGACTCTGG - Intronic
903466254 1:23554526-23554548 CCAGGCCCGCTGGGCTCCTCCGG - Intergenic
904449477 1:30601752-30601774 CCCCGCCCCTTAGTTACCTCTGG + Intergenic
905626888 1:39495252-39495274 CCCCGCCCTCTGGGTCCCACAGG - Intronic
905670046 1:39785517-39785539 CCCCGCCCCCTGGGTCCCACAGG + Intronic
906105648 1:43290544-43290566 CCCCACCCTCTCGATTCCTCAGG - Intergenic
907259945 1:53210517-53210539 CCCCGCCCCCGAGTTTCCCCTGG + Exonic
912688835 1:111788373-111788395 CCAAGCCCCGTGGTTTCCTCAGG - Intronic
917977777 1:180251222-180251244 CCTAGCCCGCTGCTTTCCTCAGG + Intronic
924167996 1:241305584-241305606 CCCTGGCAGCTGCTTTCCTCAGG + Intronic
924594614 1:245434590-245434612 CTCTGCCCGAGGGTTTCCTCTGG + Intronic
1067778078 10:49177217-49177239 CTCCACCTGGTGGTTTCCTCTGG - Intronic
1069534109 10:69240614-69240636 TCCCACCCGCTGATTCCCTCTGG + Intronic
1076630452 10:131849107-131849129 ACCCTCCCCCTGGTTTTCTCAGG - Intergenic
1076991550 11:278661-278683 CCTCACCCGCTGACTTCCTCAGG + Intronic
1083620141 11:64045195-64045217 CGCTGCCCGCTGGTGCCCTCGGG + Intronic
1084452290 11:69246312-69246334 CGCCGCACACTGGTTTCTTCTGG + Intergenic
1086337191 11:85811337-85811359 CCCCGCCTGCTGCTTCTCTCCGG + Intergenic
1096627213 12:52903448-52903470 CCCCGACCACTGGGTTCCTGGGG + Intronic
1113818606 13:113194289-113194311 CCCAGCCTCCTGGTTTCCTTGGG + Intronic
1119171776 14:72541093-72541115 CCCTGCTCCCTGGTTCCCTCTGG - Intronic
1121098038 14:91231576-91231598 CCCCATCTGCTGCTTTCCTCTGG - Intergenic
1122088363 14:99322319-99322341 CCTCTCCTTCTGGTTTCCTCCGG - Intergenic
1122449772 14:101796498-101796520 CCGGGCCCGCTGGTTCCCTGAGG - Intronic
1128059842 15:64728375-64728397 CCCTGCCCTCTGGTGGCCTCTGG + Intergenic
1130310557 15:82750270-82750292 CTCCGCCCGCGGATGTCCTCCGG - Intergenic
1132577453 16:670575-670597 CCCCGCACGCTGGTTCCCCAGGG + Intronic
1133241244 16:4415932-4415954 CCCCTCCCTCGGGTTTCCGCCGG - Intronic
1138348642 16:56334956-56334978 CCCAGCCCGCAGGTTCCCTGGGG - Intronic
1140183980 16:72750334-72750356 CCCCGGCCCCTGGTTTCATATGG - Intergenic
1141899662 16:86982913-86982935 CCCCACCTCCTGGCTTCCTCAGG + Intergenic
1145969731 17:28949903-28949925 CCCCGCCCCCAGGTGTCCGCCGG - Intronic
1147935319 17:44007500-44007522 CCCCGCCCTCTGGGGTCCGCAGG - Intronic
1151758508 17:76088027-76088049 CCCCTCTCCCTGGTGTCCTCAGG + Intronic
1160811484 19:1014802-1014824 CCCGGCCTGCTGGCTTCGTCCGG - Intronic
1160886985 19:1354778-1354800 CCCCGCCAACCGGTCTCCTCAGG + Intronic
1161724236 19:5919125-5919147 CCCTGCCCTCTGGTTTCCTTAGG + Intronic
1162301522 19:9847633-9847655 CCCTGCCTGCTGCTCTCCTCTGG + Intronic
1162720401 19:12658454-12658476 CCACCCCCGCTTGTTACCTCTGG - Exonic
1162799473 19:13102901-13102923 CCCCGCCCGCTGGTTTCCTCCGG - Intronic
1167348918 19:48963140-48963162 CCCCTCCCGCCGGGTCCCTCTGG + Intergenic
1168298393 19:55389084-55389106 CCCAGCCCTCTTGTTTCCTTTGG + Intronic
927591355 2:24360535-24360557 CCCCGCCCCCCGGCTTCCTGCGG - Exonic
929585608 2:43112334-43112356 GCCTGCCTGCTGGTTTCCTGGGG - Intergenic
932620890 2:73264492-73264514 CCCCGCCCACTGCCTCCCTCGGG + Exonic
934624484 2:95835340-95835362 CCACCCCCGCTGGTGTTCTCAGG + Intergenic
934809147 2:97266285-97266307 CCACCCCCGCTGGTGTTCTCAGG - Intergenic
934828358 2:97490884-97490906 CCACCCCCGCTGGTGTTCTCAGG + Intergenic
938291155 2:130151288-130151310 CCCCTCCCGCTAGTGTCCACAGG - Intergenic
938796175 2:134719360-134719382 CCCCTCCCACTGGATTCCTCTGG + Intergenic
1169204037 20:3730246-3730268 CCAGGCCCGCTGTTTTCCTCTGG - Intergenic
1175961818 20:62641287-62641309 ACCCCCCCGGTGGTGTCCTCAGG - Exonic
1179225067 21:39445776-39445798 CCCCGCGCGCGGGTTTCCATGGG - Intronic
1179645809 21:42775289-42775311 CCACGCCCCCCGCTTTCCTCAGG - Exonic
1180120115 21:45740237-45740259 GCCCACCCTCTTGTTTCCTCAGG + Intronic
1180513790 22:16120517-16120539 CCCCACCTACTGATTTCCTCAGG - Intergenic
1181859420 22:25806520-25806542 CCCCTCCCGCTGCCTTCCCCAGG - Intronic
1182295511 22:29309535-29309557 CCCCACCTGCTTATTTCCTCTGG + Intronic
1182844822 22:33421757-33421779 CCTGGCACCCTGGTTTCCTCAGG - Intronic
1185057614 22:48589131-48589153 TCCTGCCCGCTGGTTGCCTTGGG + Intronic
1185077963 22:48693502-48693524 CCTCACCTGCTGGTCTCCTCTGG - Intronic
1185079724 22:48702918-48702940 GCCGGCCCGCTGGTGCCCTCGGG + Intronic
952157455 3:30658831-30658853 CTCAGCCAGCTGGTTCCCTCTGG + Intronic
953925408 3:46980077-46980099 CCCAGCCCGCCGGGTGCCTCTGG + Intronic
954410396 3:50368058-50368080 GCCCGGCCTCTGGGTTCCTCTGG + Intronic
960864269 3:122184246-122184268 CCCCGCCCGCTTGCCCCCTCGGG - Intronic
961825434 3:129596732-129596754 CCCCAGCCCCTGGTCTCCTCGGG + Intronic
968002917 3:195219998-195220020 CCCAGCCTGCTCGTTTCCTGCGG - Intronic
968086594 3:195876709-195876731 CCCCAGCCGCTGGTTCCCTGTGG - Intronic
968642545 4:1721735-1721757 CCCCGGCCGCCGCTTTCCCCGGG + Intronic
975284445 4:72600822-72600844 CCCTGCCCACAGGTCTCCTCAGG + Intergenic
981270877 4:142846364-142846386 CGCCGCCTGCTAGTTTCCTCCGG - Intronic
985866344 5:2517305-2517327 CCCAGCCCCATGGTTTCCACGGG + Intergenic
985923802 5:3000134-3000156 CCCCACCCGCTGTTCTTCTCTGG + Intergenic
992011132 5:72528900-72528922 CCCCGCCACCTAGTTTTCTCTGG + Intergenic
992140925 5:73796250-73796272 CCACTCCAGTTGGTTTCCTCTGG + Intronic
996529468 5:124512436-124512458 CCCTGCCAGCTGGCTTCCACTGG - Intergenic
996619634 5:125484409-125484431 CCCAGCCCGTTGTTTTCCCCGGG + Intergenic
998435983 5:142109084-142109106 CCCTGCCCGCTGGCCGCCTCAGG + Intronic
998491573 5:142551603-142551625 CCTCCCCCGGTGATTTCCTCGGG - Intergenic
1005955419 6:30660049-30660071 CCCCGGACGCAGGTTTCCTGTGG - Exonic
1010249777 6:73695867-73695889 CCCGGCCCACCGGGTTCCTCAGG - Intronic
1011370663 6:86633713-86633735 CCACTCCCACTGGTTTTCTCTGG - Intergenic
1018885709 6:167934507-167934529 GCCCGCTCGCTGCTCTCCTCTGG - Intronic
1022047087 7:26630557-26630579 CCCCGGCTGCTGGCTTCCCCTGG - Intergenic
1026935765 7:74254441-74254463 CCCCGCCCCCTGGCTTCCGCCGG + Exonic
1026971857 7:74473316-74473338 TCCCGCCCCCTGGTTTATTCTGG + Intronic
1027189648 7:75989327-75989349 CCTCACCCGCTGCTTTCCGCAGG + Intronic
1029658928 7:101946064-101946086 CCCTGACTGCTGGTTTCCTCTGG - Intronic
1029696530 7:102217377-102217399 CCCCGCCCGCGGGTGAGCTCTGG + Intronic
1032322334 7:130896742-130896764 CCCTTCCTCCTGGTTTCCTCTGG - Intergenic
1033319950 7:140330415-140330437 CCCCGCCACCTGCTTTACTCAGG - Intronic
1034496727 7:151427598-151427620 CCACGCCAGCTGGGTTCCACAGG + Intergenic
1036228399 8:6979905-6979927 ATTCGCCCGCTGGTTCCCTCTGG + Intronic
1036230852 8:6999015-6999037 ATTCGCCCGCTGGTTCCCTCTGG + Intronic
1037348537 8:17924130-17924152 CTCCGCCTGCTGGTGTTCTCTGG + Intronic
1041252476 8:55947743-55947765 CCACGGCTGCTCGTTTCCTCAGG + Intronic
1042591275 8:70402122-70402144 CCCCGCCCCCTTCCTTCCTCCGG + Intronic
1047137092 8:122091761-122091783 CCCCTCCCACTAGTTTCCCCTGG + Intergenic
1049198659 8:141329387-141329409 CCAGGCCCGCTGCTTCCCTCCGG - Intergenic
1062055807 9:134469239-134469261 CCCAGCCCGCCGGCCTCCTCCGG - Intergenic
1062316949 9:135971988-135972010 CCCTGCCTGCTCTTTTCCTCTGG - Intergenic
1188513035 X:30957393-30957415 CCTTGCCCTCTGGTTTCCACTGG - Intronic
1190338404 X:49277235-49277257 CCTCACCCTCTGGTCTCCTCGGG + Intronic
1191071113 X:56401151-56401173 CCCTGCCAGCTGGTGACCTCTGG + Intergenic