ID: 1162799743

View in Genome Browser
Species Human (GRCh38)
Location 19:13103843-13103865
Sequence GGTGTTGATCGTGGGGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162799743_1162799753 28 Left 1162799743 19:13103843-13103865 CCCAGGACCCCACGATCAACACC No data
Right 1162799753 19:13103894-13103916 ACTAAAGTTTTATGCAGTAAAGG No data
1162799743_1162799750 4 Left 1162799743 19:13103843-13103865 CCCAGGACCCCACGATCAACACC No data
Right 1162799750 19:13103870-13103892 TTGCTTTCCTCCAAAGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162799743 Original CRISPR GGTGTTGATCGTGGGGTCCT GGG (reversed) Intergenic