ID: 1162801409

View in Genome Browser
Species Human (GRCh38)
Location 19:13112765-13112787
Sequence CGGTGTTGGCGGGGAACAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 124}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162801409_1162801419 19 Left 1162801409 19:13112765-13112787 CCCGCTGTTCCCCGCCAACACCG 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1162801419 19:13112807-13112829 ACACAGCAACCCTGCAGAGAGGG 0: 1
1: 2
2: 2
3: 38
4: 364
1162801409_1162801421 24 Left 1162801409 19:13112765-13112787 CCCGCTGTTCCCCGCCAACACCG 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1162801421 19:13112812-13112834 GCAACCCTGCAGAGAGGGGCTGG 0: 1
1: 0
2: 2
3: 30
4: 385
1162801409_1162801418 18 Left 1162801409 19:13112765-13112787 CCCGCTGTTCCCCGCCAACACCG 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1162801418 19:13112806-13112828 CACACAGCAACCCTGCAGAGAGG 0: 1
1: 0
2: 3
3: 50
4: 333
1162801409_1162801420 20 Left 1162801409 19:13112765-13112787 CCCGCTGTTCCCCGCCAACACCG 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1162801420 19:13112808-13112830 CACAGCAACCCTGCAGAGAGGGG 0: 1
1: 1
2: 5
3: 35
4: 368
1162801409_1162801422 25 Left 1162801409 19:13112765-13112787 CCCGCTGTTCCCCGCCAACACCG 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1162801422 19:13112813-13112835 CAACCCTGCAGAGAGGGGCTGGG 0: 1
1: 0
2: 4
3: 29
4: 317
1162801409_1162801415 -8 Left 1162801409 19:13112765-13112787 CCCGCTGTTCCCCGCCAACACCG 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1162801415 19:13112780-13112802 CAACACCGCCATGTCTGTGCAGG 0: 1
1: 0
2: 1
3: 9
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162801409 Original CRISPR CGGTGTTGGCGGGGAACAGC GGG (reversed) Exonic
900284646 1:1893306-1893328 CGGTGGTGTCGGGGAGCATCAGG - Intergenic
900393961 1:2445546-2445568 GGCTGTGGGTGGGGAACAGCTGG + Intronic
900435180 1:2627825-2627847 GGGTCTTGACGGGGAACAGAGGG + Intronic
901422894 1:9162772-9162794 AGGTGTTGAGGGGGTACAGCTGG + Intergenic
901957012 1:12793618-12793640 TGGTGTTGGCGAGGAAGATCAGG + Intronic
901980407 1:13029754-13029776 TGGTGTTGGCGAGGAAGATCAGG + Intronic
902001680 1:13199177-13199199 TGGTGTTGGCGAGGAAGATCAGG - Intergenic
902020907 1:13344902-13344924 TGGTGTTGGCGAGGAAGATCAGG - Intronic
904467165 1:30715061-30715083 GGGTGTGGGTGGGGAAAAGCAGG - Intronic
907414810 1:54307015-54307037 GGCTGTGGGCAGGGAACAGCTGG - Intronic
912511224 1:110191438-110191460 GGGTGATGGTGGGGAAAAGCAGG + Intronic
914242507 1:145861170-145861192 AGGTGTTGGAAGGGAGCAGCTGG - Intergenic
915304502 1:154969925-154969947 CGGGGTTGTTGGGGAACAGCAGG + Intronic
917096442 1:171403557-171403579 TGGTGTTGGCAGGGCACAGCAGG + Intergenic
920912809 1:210233542-210233564 CGGAGGTGGCGGGGGACAGAAGG - Intronic
921138713 1:212285583-212285605 CGGCGTTGACCGGGAAGAGCGGG + Exonic
1068901065 10:62269305-62269327 AGTAGTTGGCGGGGAACATCTGG - Intergenic
1072408493 10:95177398-95177420 AGGTTTTGGGGGGGAACAGGTGG - Intergenic
1073100240 10:101002662-101002684 CCGTGGTGGCGGGGAGGAGCTGG - Exonic
1074290087 10:112131826-112131848 CGGGGTTGGCGGAGAAGAGGGGG - Intergenic
1075299488 10:121309059-121309081 TGGTGTGTGCAGGGAACAGCAGG - Intergenic
1078845398 11:15114947-15114969 CAGTGGTGGCGGGGCGCAGCTGG - Intronic
1080657759 11:34271092-34271114 GGGTGATGGCGGGGAAGTGCAGG + Intronic
1083822544 11:65181429-65181451 CGGGGCTGGCTGGGAACGGCGGG + Exonic
1086450047 11:86906519-86906541 CGGAGTTGGCGAGGCACTGCGGG - Intronic
1089317368 11:117601116-117601138 GGGTGGGGGCTGGGAACAGCTGG - Intronic
1090235364 11:125142894-125142916 AGGTGCTGGCTGGGAAAAGCAGG - Intergenic
1091069079 11:132546301-132546323 AGGTTTTGGGGGGGAACAGGTGG + Intronic
1096695436 12:53345447-53345469 CTGTGGTGGCTGGGAAGAGCTGG + Intergenic
1096771692 12:53939481-53939503 CGGTGGTGCCCGGGATCAGCGGG + Exonic
1102933356 12:116878890-116878912 CGGTGTTGGGGGGCAGCAGCAGG - Intronic
1105253720 13:18725513-18725535 CGGTGGTGGCGGGAAGCAGCAGG - Intergenic
1111330697 13:86760007-86760029 GAGTGTTTGCAGGGAACAGCTGG + Intergenic
1118771118 14:68943440-68943462 CGGTGCTGGTGGGCAACAGCAGG - Intronic
1119587642 14:75851604-75851626 CGGGATTGGCGTGGAGCAGCAGG + Intronic
1119776359 14:77251502-77251524 TGGTGTTGGAGGTGACCAGCAGG + Intronic
1120858278 14:89231828-89231850 AGGTGGTGGCGGGGAACACACGG + Intronic
1120906336 14:89624357-89624379 TGGTGTTGAGTGGGAACAGCAGG + Intergenic
1123476130 15:20593523-20593545 CTGTGGTGGTGGGGACCAGCTGG + Intergenic
1123641882 15:22406841-22406863 CTGTGGTGGTGGGGACCAGCTGG - Intergenic
1125180184 15:36873652-36873674 AGGTGTTGGCTGGGAAGAGGGGG + Intergenic
1132580759 16:683700-683722 AGGTGTTGGCGGTGCTCAGCCGG + Exonic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1133497019 16:6328403-6328425 CGGTTTTTGGGGGGAACAGGTGG - Intronic
1134208104 16:12253894-12253916 CGGTGGTGGCTGGGACCAGTTGG + Intronic
1136535505 16:30896775-30896797 CGGCCTTGGCGGGGAAGGGCAGG + Intronic
1139442534 16:66975751-66975773 AGGTGTTGGCTGGGCACAGTGGG - Intergenic
1140470003 16:75208582-75208604 AGGGGTTGGCGGGCACCAGCAGG + Intergenic
1140818230 16:78639948-78639970 AGGTGTTCGCAGGGCACAGCTGG + Intronic
1142130916 16:88431076-88431098 CGGTGTTGGTGGGGACCTGCAGG - Exonic
1143772803 17:9179258-9179280 AGGTGTTGGGGGGCAGCAGCTGG + Intronic
1150326445 17:64262477-64262499 CGGAGAAGGCGGGGAACGGCTGG - Intronic
1151370374 17:73643608-73643630 CGGTGTCTGCGGGGAAGGGCAGG - Intronic
1155381845 18:25231320-25231342 CTGTGTTGGAGGAGGACAGCTGG + Intronic
1157678303 18:49583803-49583825 TGGTGTAGGTGGGGAACAGAAGG + Intronic
1161026745 19:2040459-2040481 GGGTTTGGGCTGGGAACAGCCGG - Intronic
1162394573 19:10409366-10409388 CGATGTTGGAGGGGTCCAGCCGG - Intronic
1162801409 19:13112765-13112787 CGGTGTTGGCGGGGAACAGCGGG - Exonic
1165423497 19:35733403-35733425 AGGTGCTGGCGGGGACCGGCCGG - Exonic
1168705350 19:58467422-58467444 CGCTGCTGGCGGGGAAAGGCTGG + Exonic
925930062 2:8699822-8699844 GGGTGTGGGCTGTGAACAGCAGG + Intergenic
927155671 2:20219845-20219867 TGGTGTTGGAGGGGACCAGGAGG + Intronic
930752988 2:54949971-54949993 GGGTGTGGGCAGGGAACTGCAGG - Intronic
931253270 2:60551411-60551433 CGGGGTTGCCGGGGAAGGGCAGG - Intronic
932398392 2:71463483-71463505 CGGTGGGGGCTGGGAACAGGTGG - Intronic
934049360 2:88197628-88197650 TGATGTTGGAGGTGAACAGCAGG - Intergenic
934516857 2:94993749-94993771 CAGTGTGGGCCGGGAAGAGCTGG + Intergenic
934999181 2:98995051-98995073 GAGTGGGGGCGGGGAACAGCTGG + Intergenic
938093208 2:128446668-128446690 GGGTGGTGGCAGGGAGCAGCTGG + Intergenic
938900122 2:135792541-135792563 CACTGTTGGCAGGGCACAGCAGG + Intronic
940765386 2:157784630-157784652 CTGGGCTGGCTGGGAACAGCAGG + Intronic
941023047 2:160430193-160430215 CTGGGTTGGCTGGGATCAGCTGG - Intronic
949036032 2:241816106-241816128 AGGTGTAGGCGGGTACCAGCAGG - Exonic
1170924780 20:20712691-20712713 CGGTGTCGACGGGGAACCGAAGG + Intergenic
1175272906 20:57747227-57747249 AGGGGTTGGCGGGGACCAGAGGG + Intergenic
1175633560 20:60561568-60561590 AGGTGTTGGTGGGGAGCAGGGGG + Intergenic
1176049748 20:63112450-63112472 CCGTGGTGGAGGAGAACAGCAGG + Intergenic
1176839229 21:13825509-13825531 CGGTGGTGGCGGGAAGCAGCAGG - Intergenic
1179445371 21:41426836-41426858 GGGCGGTGGGGGGGAACAGCGGG - Intronic
1179997692 21:44981558-44981580 TGGTGTTCACGGGGGACAGCGGG + Intergenic
1179997723 21:44981671-44981693 TGGTGTTCACGGGGGACAGCGGG + Intergenic
1179997806 21:44981955-44981977 TGGTGTTCACGGGGGACAGCGGG + Intergenic
1179997838 21:44982070-44982092 TGGTGTTCACGGGGGACAGCGGG + Intergenic
1180050184 21:45327537-45327559 AGGTGTTGGCAGAGACCAGCAGG + Intergenic
1180106152 21:45619352-45619374 CTGTGTTGGCAGGGCTCAGCTGG + Intergenic
1181863035 22:25834076-25834098 CAGTGTTGGCTGGGAAGGGCGGG + Intronic
1182480729 22:30607128-30607150 CTGTGGTGGCGGGGAACATAAGG - Exonic
1182655240 22:31884815-31884837 AGGTGTTGCGGGGAAACAGCAGG - Intronic
954793126 3:53147468-53147490 CGCTGTAGGTGGGGAAGAGCAGG + Intergenic
960637855 3:119801705-119801727 CTGTGTTGGCTGGGCTCAGCTGG + Intronic
960989248 3:123300121-123300143 TGGCGTTGGCGGTGACCAGCAGG + Exonic
962601744 3:136996279-136996301 GGGGGTTGGCGGGAAACATCTGG - Intronic
964767483 3:160192673-160192695 CAGTGGTGGCCTGGAACAGCTGG + Intergenic
975718391 4:77227445-77227467 TGCTGTTGGCAGGGCACAGCAGG - Intronic
975973637 4:80072226-80072248 CTGTGTGGGCGGAGATCAGCCGG - Intronic
978372882 4:108046842-108046864 CGGTGCAGCTGGGGAACAGCTGG - Intergenic
979584877 4:122404015-122404037 CTCTGTTGGCGGGGCACTGCAGG - Intronic
986712305 5:10496916-10496938 TGGTGTTGGCAGGGAAAACCTGG - Intergenic
987434945 5:17883402-17883424 CACTGTTGGTGGGGCACAGCGGG - Intergenic
996398243 5:123034470-123034492 CAGTGTGGGCGGGGAACCACTGG - Intronic
996749296 5:126872944-126872966 CGCTGTTGGCCCTGAACAGCTGG - Intronic
997195385 5:131975646-131975668 CTTTGCTGGCGGGGCACAGCAGG - Intronic
997258635 5:132448424-132448446 CAGAGTTGGCTGGGAGCAGCAGG - Intronic
997760894 5:136446374-136446396 GGCTGTTGGCGGGGGACAGTGGG + Intergenic
1003824897 6:9942273-9942295 CGGGGCTGGCGGGGGCCAGCCGG - Intronic
1005838784 6:29726261-29726283 GGGTGTTGGGGGGGAACAGAGGG + Intronic
1006025686 6:31145284-31145306 CGGTGGTGGTAGGGGACAGCTGG + Exonic
1013514556 6:110874405-110874427 GGGTGTTGGCGGGGTTCAGCGGG - Intronic
1019450095 7:1093129-1093151 CAGGGTTGGCGGGGAGGAGCTGG - Exonic
1022171930 7:27839293-27839315 CAGTGGTGGGGAGGAACAGCTGG + Intronic
1022319965 7:29278989-29279011 GGGGGTTGGGGGGGGACAGCTGG - Intronic
1024038821 7:45533478-45533500 CAGTGTTGGCCTGGGACAGCCGG - Intergenic
1026018699 7:66692477-66692499 TGGTTTTGGGTGGGAACAGCTGG - Intronic
1031950226 7:127884457-127884479 CGCTATTGGCTGGGAGCAGCTGG - Intronic
1035640920 8:1184662-1184684 CGGAGTTTGCGGGAAACAGTGGG + Intergenic
1035650133 8:1257690-1257712 CAGTGCTGGCGTGGAAGAGCCGG + Intergenic
1035725745 8:1824022-1824044 GGGGGACGGCGGGGAACAGCGGG + Exonic
1035725753 8:1824042-1824064 GGGGGACGGCGGGGAACAGCGGG + Exonic
1035725760 8:1824062-1824084 GGGGGACGGCGGGGAACAGCAGG + Exonic
1042435400 8:68758461-68758483 TGGTCTTGGCTGGGAACACCAGG + Intronic
1042752187 8:72170298-72170320 TGGGGTTAGTGGGGAACAGCCGG + Intergenic
1043171499 8:76972344-76972366 CGGTGTGGGTGGGGGGCAGCAGG + Intergenic
1043291988 8:78613378-78613400 CGGTATTGGCGAGGAACAGGTGG + Intergenic
1049550265 8:143254365-143254387 AGCTGTTGGCAGGGAAGAGCCGG + Intronic
1049665045 8:143839293-143839315 CGGTGCTGGCGGGGCAGGGCTGG - Exonic
1049774546 8:144398357-144398379 CGGTCTTTGCTGGGAACATCGGG - Exonic
1051174204 9:14347211-14347233 CGCTTTCGGCGGGGAACTGCGGG - Intronic
1053919635 9:42974957-42974979 CGGTGGTGGCGGGAAGCTGCAGG + Intergenic
1056581152 9:87888721-87888743 CTGTGGTGGTGGGGACCAGCTGG - Exonic
1057482851 9:95459312-95459334 CGGTGTTCACAGGGAACAGCTGG + Intronic
1060540112 9:124423663-124423685 CCGTGGAGGCGGGAAACAGCTGG + Intergenic
1061900671 9:133670553-133670575 CCGGGTGGGCGTGGAACAGCGGG + Intronic
1189705378 X:43754396-43754418 GGGACTTGGCGGGGAAGAGCGGG - Intergenic
1190236277 X:48618085-48618107 GGATGTTGGCAGAGAACAGCAGG + Intergenic
1192905270 X:75544541-75544563 TGCTGTTGGTGGGGCACAGCAGG - Intergenic
1199248153 X:145630924-145630946 CGGTGCTGGCGCGGAACAGTGGG + Intergenic
1200134991 X:153870449-153870471 TGGAGTTGGTGGGGAAGAGCAGG + Exonic