ID: 1162805522

View in Genome Browser
Species Human (GRCh38)
Location 19:13136200-13136222
Sequence GAGAGTGGCACGCGAGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162805522_1162805532 16 Left 1162805522 19:13136200-13136222 CCTGCCACTCGCGTGCCACTCTC 0: 1
1: 0
2: 2
3: 10
4: 102
Right 1162805532 19:13136239-13136261 GGTGGAGGCCCTCCCGGAGCAGG 0: 1
1: 0
2: 0
3: 26
4: 259
1162805522_1162805531 10 Left 1162805522 19:13136200-13136222 CCTGCCACTCGCGTGCCACTCTC 0: 1
1: 0
2: 2
3: 10
4: 102
Right 1162805531 19:13136233-13136255 CGAGAAGGTGGAGGCCCTCCCGG 0: 1
1: 0
2: 1
3: 15
4: 274
1162805522_1162805525 -5 Left 1162805522 19:13136200-13136222 CCTGCCACTCGCGTGCCACTCTC 0: 1
1: 0
2: 2
3: 10
4: 102
Right 1162805525 19:13136218-13136240 CTCTCTCCCTGCAGCCGAGAAGG 0: 1
1: 0
2: 3
3: 19
4: 241
1162805522_1162805528 1 Left 1162805522 19:13136200-13136222 CCTGCCACTCGCGTGCCACTCTC 0: 1
1: 0
2: 2
3: 10
4: 102
Right 1162805528 19:13136224-13136246 CCCTGCAGCCGAGAAGGTGGAGG 0: 1
1: 0
2: 6
3: 42
4: 841
1162805522_1162805526 -2 Left 1162805522 19:13136200-13136222 CCTGCCACTCGCGTGCCACTCTC 0: 1
1: 0
2: 2
3: 10
4: 102
Right 1162805526 19:13136221-13136243 TCTCCCTGCAGCCGAGAAGGTGG 0: 1
1: 0
2: 1
3: 13
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162805522 Original CRISPR GAGAGTGGCACGCGAGTGGC AGG (reversed) Intronic
902232692 1:15037679-15037701 GGGAGTGGCAGGTGAGGGGCCGG - Intronic
906500995 1:46341731-46341753 GAGTGGGGAACCCGAGTGGCAGG - Intronic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
907296036 1:53455212-53455234 GAGAGTGGAACTAGAGAGGCTGG + Intergenic
908173282 1:61528888-61528910 GGGATTGGCAAGAGAGTGGCAGG + Intergenic
908613555 1:65890641-65890663 GAGAGTCCCACGAGAGTGGTGGG + Intronic
913176002 1:116273743-116273765 GAGAGTGACTGGGGAGTGGCGGG - Intergenic
914342698 1:146773832-146773854 GGAACTGGGACGCGAGTGGCTGG + Intergenic
916503608 1:165408033-165408055 GAGTGTGGCAGGCGCGTGTCTGG - Intronic
920731300 1:208488413-208488435 GCGCGTGGCACGGGACTGGCAGG - Intergenic
922412909 1:225392971-225392993 GACAGTGGCGTGGGAGTGGCAGG - Intronic
922823420 1:228500743-228500765 GAGAGAGGCAGGGGAATGGCTGG + Intergenic
1062957001 10:1547041-1547063 GAGAGCGGGACGCGGGTGGGAGG + Intronic
1063672584 10:8111351-8111373 GAGAGTGGGACACGAGTTGACGG + Intergenic
1064401127 10:15022147-15022169 GAGAGGGGAACGGGAGTGGTAGG - Intergenic
1064491281 10:15860106-15860128 GAGCGGGGCACGCGAGGGGCTGG + Intronic
1066213119 10:33259279-33259301 GAGAGTGGCACGCTGTTGTCCGG - Intronic
1070646311 10:78204510-78204532 GGGAGGGGCAGGTGAGTGGCAGG + Intergenic
1071343647 10:84670873-84670895 GAGAGTGGCATGTGAGTTGGTGG - Intergenic
1072786624 10:98287552-98287574 GAGACTGGCATGGGAGTGGGTGG - Intergenic
1073121237 10:101123556-101123578 GCGGGTGGCGCGCGGGTGGCAGG + Intronic
1074088684 10:110227148-110227170 GAGAGGGGCACGCGCGTGTGTGG + Intronic
1075801620 10:125158545-125158567 GAGAGTCTGATGCGAGTGGCTGG - Intronic
1076663391 10:132069985-132070007 GAGAGTGACACGGGGCTGGCAGG + Intergenic
1076698247 10:132257323-132257345 GACAGTGGCACGGGTGTGGGAGG - Intronic
1076828099 10:132980542-132980564 GAGAGTGCCCAGCGAGTGCCCGG + Intergenic
1077824711 11:5793755-5793777 GAGAGAGACAGGAGAGTGGCTGG - Intronic
1078413469 11:11146843-11146865 CAGAGTGGTAGACGAGTGGCAGG - Intergenic
1083287727 11:61671176-61671198 GAGAGTGGCACGAGATAGGGTGG + Intergenic
1083292962 11:61699935-61699957 GAGGGTGGCAGGCAGGTGGCCGG + Intronic
1084033753 11:66495603-66495625 GAGAGGGGCAGGCAGGTGGCAGG - Intronic
1084788748 11:71459746-71459768 GAGGGTCGCACGCGAGTGGCAGG - Intronic
1085174254 11:74472904-74472926 GAGAGAGGCAAGTGAGGGGCCGG + Intergenic
1090203984 11:124874986-124875008 GAGAGTGGGAGGTGAGTGGCTGG + Intronic
1094526346 12:31233806-31233828 GTGGGTGGAAAGCGAGTGGCAGG - Intergenic
1097308035 12:58090559-58090581 GAGAGTGGCTGGTGAGTAGCAGG - Intergenic
1097793463 12:63839493-63839515 GAGTGTGGCAGGGGAGAGGCAGG + Intergenic
1103871357 12:124094707-124094729 GAGAGTGCCGCGAGAGTGGCAGG + Intronic
1108577685 13:51803819-51803841 GAGACTGGCGCCCGAGGGGCGGG - Intronic
1117559157 14:56918133-56918155 GTGAGTGGAAGGTGAGTGGCAGG - Intergenic
1120624108 14:86803411-86803433 GAGATTGGCATGTGAGTGGGTGG + Intergenic
1121757223 14:96413281-96413303 GAGAGTGGCTCTGGAGGGGCAGG - Intronic
1122938007 14:104968701-104968723 GAGACTGGCTCTCCAGTGGCCGG + Intronic
1123703149 15:22930932-22930954 GTGAGTGGCGAGCGAGTGGGAGG - Intronic
1128014873 15:64334782-64334804 GTGAGTGGCAGGTGAGTGGCAGG - Intronic
1128151754 15:65367621-65367643 GAGAGTGGCCAGCGGGTGGCGGG - Intronic
1129111673 15:73340686-73340708 GAGAGTGGGAGGGCAGTGGCAGG - Intronic
1130093570 15:80840271-80840293 GTGAGTGGAACGCGAGTGGATGG - Intronic
1132548667 16:545250-545272 GAGGGTGGCCCTAGAGTGGCTGG + Intronic
1136358753 16:29763964-29763986 ATGAGTGGCATGCGTGTGGCAGG - Intergenic
1139643648 16:68311302-68311324 GACAGAGCCCCGCGAGTGGCAGG - Exonic
1139991287 16:70941496-70941518 GGAACTGGGACGCGAGTGGCCGG - Intronic
1141724736 16:85780311-85780333 GAGAGTGGCTCTCACGTGGCCGG + Intronic
1143022390 17:3923652-3923674 GAGAGCCACACTCGAGTGGCAGG - Intergenic
1147123990 17:38352838-38352860 GAGAAGGACCCGCGAGTGGCCGG - Exonic
1152647746 17:81477587-81477609 GAGAGAGGGACAGGAGTGGCTGG - Intergenic
1157306324 18:46520177-46520199 GCGAGAGGCAGGAGAGTGGCAGG + Intronic
1157722872 18:49938860-49938882 GAGAGGGTCACGGGAGGGGCAGG - Intronic
1158892105 18:61882454-61882476 GAAAGAGGCACGCAAGTGTCTGG + Intronic
1160783597 19:889564-889586 GAGAGGGGCTGGCGGGTGGCTGG + Intronic
1161110895 19:2469452-2469474 GACAGTGGCAGGGGAGGGGCAGG - Intergenic
1161245486 19:3249489-3249511 GAGGGTGGGAAGCGAGGGGCGGG - Intronic
1161471197 19:4457488-4457510 GGGAGCGGCACGCGAGGGTCAGG - Intronic
1162805522 19:13136200-13136222 GAGAGTGGCACGCGAGTGGCAGG - Intronic
1162894567 19:13757579-13757601 GAGACGGGCACCCGAGTGACTGG + Intronic
1167151726 19:47713884-47713906 GAGAGGGGCTCTTGAGTGGCTGG - Intronic
1167214681 19:48156644-48156666 GAGAAAGGCAGGCGACTGGCTGG + Intronic
927957943 2:27221279-27221301 GCGGGTGGCACTCCAGTGGCTGG - Exonic
933660051 2:84920285-84920307 GAGATTGGCATGTGAGTGGGTGG + Intergenic
936077624 2:109411724-109411746 GAGCGTGGCTCCCGTGTGGCCGG - Intronic
940361864 2:152804788-152804810 CACAGTGGCACGGGACTGGCAGG - Intergenic
1168837751 20:888967-888989 GAGAGTGGCAGGCAAGGAGCTGG - Intronic
1173867798 20:46323648-46323670 GGGAGGGGCACCCGAGTAGCAGG - Intergenic
1175287221 20:57844978-57845000 GAGAGTGGCTCGCTAGTGGCTGG - Intergenic
967276888 3:187784687-187784709 GAGAGTGGGAGGTGAGGGGCTGG + Intergenic
968799313 4:2731883-2731905 GAGAGGGACACGCGAGAGGCAGG + Exonic
975540796 4:75509690-75509712 GAGAATGGCACGGGAGAGTCTGG - Intronic
978005411 4:103609749-103609771 GAGAGTGGCAGGAGAGGGGATGG - Intronic
978980144 4:114934617-114934639 GAGAGTAGGATGCCAGTGGCTGG + Intronic
979500637 4:121435843-121435865 GAGACTGGGAAACGAGTGGCAGG - Intergenic
984526631 4:180866243-180866265 CAGAGTGGCAAGGGGGTGGCGGG + Intergenic
985750830 5:1673327-1673349 GAGGGTGGCACGGAAGTGTCAGG - Intergenic
988918966 5:35923125-35923147 GAGAATGGGAGGTGAGTGGCTGG - Intronic
1001731348 5:173962597-173962619 GAAAGTGGCTCACAAGTGGCAGG - Intergenic
1001820506 5:174706464-174706486 AAGAGTGACAGGAGAGTGGCAGG - Intergenic
1005751234 6:28885108-28885130 GTGCGTGGCACGGGACTGGCGGG - Intergenic
1007557802 6:42781957-42781979 GAGAGCGGAGCGCGTGTGGCCGG + Intronic
1007783035 6:44265048-44265070 GGGAGTGGCAGGCGTGGGGCCGG + Exonic
1013684068 6:112558392-112558414 GAGATTGGCACGTGAGTTGGTGG - Intergenic
1017245136 6:152216548-152216570 CACAGTGGCACGGGAGTGGCTGG + Intronic
1017383441 6:153856903-153856925 GCGTGTGGCACGGGACTGGCGGG - Intergenic
1019553254 7:1614463-1614485 CATAGTGTCTCGCGAGTGGCAGG + Intergenic
1021741790 7:23693983-23694005 GAGGGTGGGAGGCGAGTGGAGGG - Intronic
1027035546 7:74922616-74922638 GATAGTAGCAGGTGAGTGGCAGG + Intergenic
1029274066 7:99393850-99393872 GACAGTGGCATGCGAGGTGCAGG - Intronic
1029394513 7:100298521-100298543 GATAGTAGCAGGTGAGTGGCAGG - Intergenic
1033442933 7:141396367-141396389 GAAAAAGGCAGGCGAGTGGCAGG - Intronic
1033832771 7:145273230-145273252 GTGAGTGGGAGGTGAGTGGCAGG - Intergenic
1034422711 7:150997806-150997828 GACAGGGGCAGGGGAGTGGCAGG - Intronic
1036801433 8:11795150-11795172 GCGGATGGCACGGGAGTGGCAGG + Intergenic
1041377465 8:57218036-57218058 GAGTGTGGTACGAGAGTGGTTGG + Intergenic
1048484216 8:134832124-134832146 GTGAGGGGCGCGCGAGGGGCGGG + Intergenic
1056771986 9:89484187-89484209 GGGAGAGGCAAGCGAGGGGCCGG + Intronic
1058781161 9:108336946-108336968 GAAAGTGGCAAGGGAGTGGAGGG + Intergenic
1060529232 9:124338718-124338740 GAGGTTTGCACGAGAGTGGCAGG - Intronic
1060555477 9:124505295-124505317 GCGAATGCCACGCGGGTGGCTGG + Intronic
1061422174 9:130478363-130478385 GAGGGTGGGAGGCGGGTGGCAGG + Intronic
1062044810 9:134420075-134420097 GAGAGTGGCCGGCTAGTGGCTGG + Intronic
1062067570 9:134537057-134537079 GAGAGTGGCACGGGTGCAGCAGG + Intergenic
1062435477 9:136545047-136545069 GAGAGCGGGACGCGGGTGGGGGG - Intronic
1062625087 9:137438899-137438921 GAGGGTGGCACGGGAGAGGCAGG - Intronic
1188890518 X:35606336-35606358 GAGAGTGGCACGCCAAGGGATGG + Intergenic
1190319694 X:49172669-49172691 GAGAGTGACACCAGAGAGGCAGG - Intronic
1190876485 X:54463882-54463904 GAGGGTGGCATGACAGTGGCTGG - Intronic
1200155409 X:153972308-153972330 GACAGCGGCACGCAGGTGGCCGG + Exonic