ID: 1162807174

View in Genome Browser
Species Human (GRCh38)
Location 19:13144115-13144137
Sequence GGCAAATGGCTTTGGGGTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162807166_1162807174 5 Left 1162807166 19:13144087-13144109 CCAGGTTGGCACGTGTATAAGGC 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1162807174 19:13144115-13144137 GGCAAATGGCTTTGGGGTCCTGG 0: 1
1: 0
2: 2
3: 26
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162807174 Original CRISPR GGCAAATGGCTTTGGGGTCC TGG Exonic
900411016 1:2512745-2512767 GGCTCAGGGCTTTGGGGCCCAGG - Intronic
902109356 1:14065007-14065029 GGGAACAGGCTTTGGGGCCCTGG + Intergenic
904081924 1:27877671-27877693 GGCCACTGGCTTCAGGGTCCAGG - Intronic
904676215 1:32200805-32200827 GGCACATGGCTTTGGAGCCCGGG + Intronic
907808151 1:57841731-57841753 GAAAAATGGTTTTGGGGACCAGG - Intronic
910387736 1:86704060-86704082 GGCACATAGCGTTGAGGTCCCGG + Intergenic
911690990 1:100834683-100834705 AGCAAATAGCTTTGGAGTCCAGG + Intergenic
919893418 1:201992670-201992692 GGCAAGGGGCTTTGGGGTGTTGG - Intronic
923544310 1:234913191-234913213 GGGTGATGGCTTTGGGGCCCAGG - Intergenic
923648810 1:235852345-235852367 CACAAATGGCTTTGAGGTACAGG - Intronic
1063111005 10:3037429-3037451 GGCACCTGGCATTGGGGTGCAGG + Intergenic
1063422139 10:5921472-5921494 GGCAAGTGGCCTTGTTGTCCCGG + Exonic
1063621681 10:7654883-7654905 GGCAAATGAATTTGGGGTATGGG + Intronic
1066476803 10:35755299-35755321 GTCATTTGGTTTTGGGGTCCTGG - Intergenic
1070711585 10:78686970-78686992 GCCTAATGGCTTTGGCTTCCTGG - Intergenic
1071785327 10:88893189-88893211 GGCAAATGAATTTGAGGTGCTGG - Intronic
1072883182 10:99248777-99248799 TGCACAGGGCATTGGGGTCCTGG - Intergenic
1073291487 10:102415418-102415440 GTCAAATGGCTTTGAGGAGCTGG + Intronic
1074290776 10:112136764-112136786 AGGAAAGGGCTTTGGGGGCCAGG + Intergenic
1075080754 10:119382008-119382030 GGCTGGTAGCTTTGGGGTCCTGG - Intronic
1076123324 10:127953660-127953682 GGCAAATGACCATGGGGTGCAGG - Intronic
1077915626 11:6609871-6609893 GGCAAAGGGCTTTTGGGGCCTGG - Intronic
1079128728 11:17735602-17735624 GGAAAATGGGTTGGGGGGCCGGG - Exonic
1081769002 11:45635710-45635732 GGAAAATGGTTTTGTGGTCTGGG + Intergenic
1081774123 11:45665902-45665924 GGCGAAAGGCTTTGGCGGCCCGG - Intergenic
1084334082 11:68446805-68446827 GGGAAATGGCTGTGGCGTCGAGG + Intronic
1084683602 11:70681021-70681043 GGCAACTGGCTCTGGGGTGCTGG + Intronic
1085785583 11:79445636-79445658 GGCAAGTGGCTTGGGAGTTCTGG - Intergenic
1089680127 11:120114780-120114802 GAAGCATGGCTTTGGGGTCCAGG - Intronic
1091251583 11:134148443-134148465 GGCAAGTGGGTTTGGGGTGAAGG + Intronic
1091956688 12:4649729-4649751 GGCAAAGTGCGTTGGGGTCTGGG + Intronic
1092761882 12:11818118-11818140 GGGAAAGGGCCTTGGGGGCCAGG + Intronic
1092773042 12:11915814-11915836 GGGGAAAGGCTTTGGGGTCAGGG + Intergenic
1094295579 12:28901171-28901193 GGAAAATGGTTTTGTGGGCCAGG + Intergenic
1095413220 12:41946585-41946607 GAAAAATGGCTTTGTGGGCCAGG - Intergenic
1095638205 12:44456151-44456173 GGAAAATGACTTTGAGTTCCAGG - Intergenic
1097185216 12:57193053-57193075 GGCAAAAGGCTTTGGGGGGCTGG - Intronic
1097392508 12:59032864-59032886 GCCTAATGGCTTTGAGGTCCTGG + Intergenic
1100858552 12:98780103-98780125 GGCAACTGGATTTAGGTTCCAGG - Intronic
1102584703 12:113914883-113914905 GGAAGATGGCCTTTGGGTCCTGG - Intronic
1102965309 12:117120938-117120960 GGCCAATGCCTCTGGGGGCCTGG + Intergenic
1103728167 12:123009289-123009311 AGCAGATGGCCTGGGGGTCCTGG - Intronic
1103729114 12:123014182-123014204 GGCATATAGATTTGGGGGCCTGG - Intronic
1107616825 13:42177949-42177971 GGCAAAAGGCTTTCGGTTTCTGG - Intronic
1107977564 13:45704597-45704619 GGCACATGGCTTAGGGGACAGGG + Intronic
1108425316 13:50293290-50293312 GCCAAAAGGCTTAGGGCTCCTGG - Intronic
1109003911 13:56844663-56844685 GGCAAATGGCTTGGGTGATCAGG + Intergenic
1111373815 13:87352597-87352619 GGGAAAGGGCTTTGGGGGTCAGG + Intergenic
1111635925 13:90903582-90903604 GGCAAAAGGTATTGGGCTCCTGG - Intergenic
1111656636 13:91162133-91162155 GGGAAATGGGTTTGGGCTCTGGG + Intergenic
1114597172 14:23923315-23923337 GGCAGATGGCTTTGAGCTCAGGG + Intergenic
1114794110 14:25692985-25693007 AGCAAATGGTTTTGGAGTTCCGG + Intergenic
1117911894 14:60644470-60644492 GTCAAATAGCTTTGAGTTCCAGG - Exonic
1118235690 14:64003169-64003191 GACACATGGCTATGGGGTACAGG + Exonic
1119718493 14:76875198-76875220 GGCTAAATGCTGTGGGGTCCAGG + Intergenic
1120675924 14:87421135-87421157 TGCAAATGCCTTTGAGGGCCAGG + Intergenic
1120947474 14:90012009-90012031 AGGAAATGGCTTTGTGGGCCAGG + Intronic
1121734800 14:96210872-96210894 GGAGAGTGGCTTTTGGGTCCAGG - Intronic
1122312824 14:100807967-100807989 GGCAAAGCTCTTTGGGGTCGTGG - Intergenic
1122924453 14:104893193-104893215 TGCAAAGGGCTGTGGGGACCTGG - Intronic
1123630532 15:22257527-22257549 GGCGAATGGGATTGGGGACCCGG + Intergenic
1130649753 15:85755823-85755845 TGGAAATGGCTTTGGAGCCCTGG + Intergenic
1131435021 15:92415459-92415481 CCCAAATGCCTTTAGGGTCCAGG + Intronic
1132179950 15:99744695-99744717 TGCACATGGCTCAGGGGTCCTGG + Intergenic
1133313916 16:4870362-4870384 GCCCTTTGGCTTTGGGGTCCTGG + Intronic
1134170065 16:11961336-11961358 GTCAAATTCCTCTGGGGTCCAGG - Intronic
1134609991 16:15600361-15600383 GAGAAACGGCTTTGGGGTCGGGG - Intronic
1135923612 16:26673053-26673075 GGCTGATGCCTTTGGGGTCCAGG + Intergenic
1136120556 16:28130447-28130469 GGTAAATGGCTATGGGAACCAGG + Intronic
1136283555 16:29228540-29228562 GGCCTATGGCTTTGGGCACCAGG + Intergenic
1136629809 16:31483291-31483313 GGCTGCTGGCTTTGGGGGCCTGG + Intronic
1138113023 16:54339694-54339716 GGGAGATGGTTTTGGGGACCTGG + Intergenic
1140454072 16:75094428-75094450 TGCATAAGGCTTTGGAGTCCAGG + Intronic
1140992974 16:80232162-80232184 GGCCAAGGGCTTTGGGGTCAAGG - Intergenic
1141972558 16:87493122-87493144 GGCGAATGGGATTGGGGACCCGG - Intergenic
1142087979 16:88194490-88194512 GGCCTATGGCTTTGGGCACCAGG + Intergenic
1143220368 17:5256278-5256300 GTGAAATGGCATTGGGGGCCGGG + Intergenic
1143780437 17:9226144-9226166 GGCAAAGGGATTTGGGGTCGGGG + Intronic
1144177753 17:12723397-12723419 GGCAACTGGATCTAGGGTCCGGG - Intronic
1144686193 17:17227867-17227889 GGCAAGTGTCTTTGGGGTCTTGG - Exonic
1147360528 17:39927169-39927191 TGGAGATGGCTGTGGGGTCCCGG - Intronic
1150004391 17:61460973-61460995 GGCAATTGGCTTTGAAGCCCCGG - Intronic
1150709662 17:67519833-67519855 GGCAAGTGGTTTTGGGGTTCTGG - Intronic
1152740537 17:82016575-82016597 GGCAGCTGGCTCTGAGGTCCAGG - Intronic
1153404616 18:4722740-4722762 GGAAAATGGATTCTGGGTCCTGG - Intergenic
1153667685 18:7381015-7381037 GGTAAATGGATAGGGGGTCCAGG + Intergenic
1153751032 18:8231024-8231046 GGTAAATGGCTCTTTGGTCCTGG - Intronic
1154500558 18:14994627-14994649 GGGAAATAGCTTTGGGGTACTGG + Intergenic
1155777959 18:29792066-29792088 GGCACATGTCTGTGGAGTCCAGG + Intergenic
1155912774 18:31523827-31523849 GGCAGATGGCTCCAGGGTCCTGG + Intronic
1158843167 18:61410476-61410498 GTCAAATTGATTTGGGGTTCTGG - Intronic
1159060827 18:63512207-63512229 AGGAAATGGCTGTGGGGTCGCGG + Intergenic
1162807174 19:13144115-13144137 GGCAAATGGCTTTGGGGTCCTGG + Exonic
1163829061 19:19539147-19539169 GGTACCTGGCTTTGGGGGCCTGG + Intronic
1167569843 19:50280256-50280278 CGAAATTGGCCTTGGGGTCCCGG + Exonic
1167710205 19:51105765-51105787 GGCCAGGAGCTTTGGGGTCCAGG + Intronic
1167780744 19:51597375-51597397 GGCCAGAAGCTTTGGGGTCCAGG - Intergenic
925225214 2:2178289-2178311 AGCAAATGGCTTGGGGGTCTGGG - Intronic
926157624 2:10466035-10466057 GGCAGATGGCTTTGGGGTACAGG - Intergenic
934566378 2:95343893-95343915 AGGAAATTGCTTTGGGGTCGGGG - Intronic
935587326 2:104813297-104813319 GGCACCTGGCTCTGGGGTCCAGG + Intergenic
936627600 2:114165016-114165038 GGCACATAACTTTGGGGTCCAGG - Intergenic
937380709 2:121374095-121374117 GGAAAATGGTTTTGTGGGCCAGG + Intronic
938499761 2:131824955-131824977 GGGAAATAGCTTTGGGGTACTGG + Intergenic
940617663 2:156070354-156070376 TACAAATGACTTTGGGATCCTGG + Intergenic
944011499 2:194979760-194979782 GGAAAATGGTTTTGTGGGCCAGG - Intergenic
944889928 2:204106903-204106925 AACAAATGGCTTTGGAGGCCGGG - Intergenic
946448171 2:219757555-219757577 AGCAGAGGGCTGTGGGGTCCAGG - Intergenic
946712197 2:222517714-222517736 GGCAAATGCTTTTGGGGCTCTGG - Intronic
947722881 2:232380146-232380168 GGCAGGTGGATTTGGGGCCCTGG - Intronic
947727227 2:232408227-232408249 GGCAGGTGGATTTGGGGGCCTGG - Intronic
1169189250 20:3646924-3646946 GGGAAATGGCTGTGCGGTGCGGG + Exonic
1170221920 20:13950488-13950510 GGCAAATCGATTTGAGGTCCTGG + Intronic
1173412721 20:42828569-42828591 GAAAAATGGCTTTGTGGGCCAGG + Intronic
1175144659 20:56886391-56886413 AGCAAGAGGCTCTGGGGTCCAGG + Intergenic
1175471505 20:59233137-59233159 AGCAACTGGCTCTGAGGTCCAGG + Intronic
1181155565 22:20917842-20917864 GGCAGACGGCTTTGGGGCCGAGG - Exonic
1181441060 22:22935452-22935474 GGCAAATGCCTTTGCCTTCCTGG + Intergenic
1182060363 22:27392912-27392934 GGCAAATGGAACTGGGGACCAGG - Intergenic
1183073256 22:35410911-35410933 GTGAGTTGGCTTTGGGGTCCTGG + Intronic
1184068331 22:42132884-42132906 GGCAGATGGCTCTGGGTTCCAGG + Intergenic
1184110199 22:42389731-42389753 GGCAAAGGGCCTGGGGGGCCTGG - Intronic
1184769182 22:46587948-46587970 GGCAAAAGGCCTGAGGGTCCAGG + Intronic
1184823932 22:46934303-46934325 GGCACTGGGCTTTGGAGTCCTGG + Intronic
949448009 3:4155834-4155856 GGCAAATTGATTTTTGGTCCTGG - Intronic
949837166 3:8281499-8281521 AGCAAATGGCTTTAGGCTCCAGG + Intergenic
951473666 3:23082249-23082271 GGCTGAGGGCTTTGGGGTCAGGG - Intergenic
952763413 3:36935079-36935101 GGCAGATGGGGTTGGGGGCCTGG - Intronic
953640409 3:44701740-44701762 AGAAAATGGCTTTGGAGGCCGGG - Intergenic
956723852 3:72140939-72140961 GGCAATTGGCTTGGGGCTGCTGG + Intergenic
957300878 3:78390127-78390149 GGAAAATGGCTTTGTGGGCCAGG + Intergenic
961168836 3:124781421-124781443 GGCATATTGCTGTGGGGACCAGG - Intronic
961216651 3:125165219-125165241 GTGAAATGGCTGTGGGATCCTGG - Intronic
961643744 3:128381416-128381438 GGAAACTGGCTTTGGGGGCTGGG + Intronic
962500942 3:135991672-135991694 GAAAAATGGCTCTGGGGTCTAGG - Intronic
963852217 3:150220323-150220345 GGCAAATGGCCTTGGCGTTAGGG - Intergenic
965395002 3:168152605-168152627 GGAAAATGGATTTGTGGGCCAGG + Intergenic
967121461 3:186386078-186386100 GGCCAATGGCTTTGGCATGCAGG - Intergenic
970911906 4:21286434-21286456 GGTATATGGCTTTGGGGTAAAGG + Intronic
971304211 4:25466005-25466027 GGCAGATGGCAGTGGGGGCCAGG + Intergenic
974806074 4:66882614-66882636 GGAAAATGGTTTTGTGGGCCAGG + Intergenic
975736389 4:77385348-77385370 GGGAGATGGCTTTAGAGTCCAGG + Intronic
977952873 4:102993966-102993988 GAAAAATGGCTTTGTGGGCCAGG - Intronic
979781615 4:124658482-124658504 GGTAAAAATCTTTGGGGTCCTGG + Intergenic
985201388 4:187488670-187488692 AGAAAATGGTTTTGTGGTCCAGG + Intergenic
986253360 5:6081428-6081450 GGCAGATGGCATTGGCTTCCTGG - Intergenic
986975365 5:13387801-13387823 GGAAAATGGTTTTGTGGACCAGG + Intergenic
987536833 5:19200319-19200341 GCCAAGTGGCTTTGGAGCCCGGG - Intergenic
989400433 5:41002260-41002282 GGCAAAAGGATTTTGGGTGCTGG + Intronic
991190583 5:63868474-63868496 TGCAAATGAATTTGGGGGCCTGG - Intergenic
994548693 5:101204826-101204848 AGAAAATGGTTTTGTGGTCCAGG + Intergenic
995654815 5:114413652-114413674 GGCAAGGGGCTTTGAGATCCTGG + Intronic
997602406 5:135149690-135149712 TGGAAATGGCTGTGGGGTCCAGG + Intronic
997914507 5:137910896-137910918 GGCAAATAGCTTTGGGTGCTGGG - Intronic
998234320 5:140385029-140385051 GGATAATGGCTATGGGGTGCAGG + Intergenic
998507849 5:142686370-142686392 GGCCAATGGCTCTGTGTTCCTGG - Intronic
998560434 5:143166337-143166359 TGCTTAGGGCTTTGGGGTCCAGG + Intronic
999314693 5:150576077-150576099 GCCAAATGACTTAGGGGCCCTGG - Intergenic
999940292 5:156535082-156535104 GGGAAATGGCTTTTGGCTTCTGG - Intronic
1002951400 6:1815964-1815986 GGGAAATGGATTTGGTGTCATGG - Intronic
1003421758 6:5964823-5964845 TTCAAAGGCCTTTGGGGTCCTGG + Intergenic
1004560606 6:16746125-16746147 GGCTCCTGGCTTTGTGGTCCAGG - Intronic
1005449862 6:25962146-25962168 GAGAAAAGGCTGTGGGGTCCAGG - Intergenic
1006030755 6:31175152-31175174 GGCAAGTGGCTTAGGGTTCCAGG + Intronic
1010786117 6:80003882-80003904 GCTAAGTGGCTTTGTGGTCCAGG - Intronic
1012867509 6:104635439-104635461 GGGAAAACACTTTGGGGTCCAGG + Intergenic
1014341554 6:120214044-120214066 GGCAAATGTTTTTGGTGTGCTGG - Intergenic
1017133152 6:151125237-151125259 GGGAAATAGCTTTGGGGTACTGG + Intergenic
1018033408 6:159862322-159862344 GGCTTGTGGCTTTGGGGTCCTGG + Intergenic
1018219945 6:161567905-161567927 GGGAAATGGCTGTGAGATCCAGG + Intronic
1018669334 6:166166798-166166820 AGTACATGGCGTTGGGGTCCAGG + Exonic
1019710568 7:2516478-2516500 AGCCCATGGCTTTGGGGACCTGG + Intronic
1021472655 7:21023412-21023434 GGCAAATGGCTTTGAGTACCTGG + Intergenic
1022473672 7:30697067-30697089 GGCAAATGGCCCTGGAGCCCCGG + Intronic
1024024028 7:45396286-45396308 GGGCAGAGGCTTTGGGGTCCAGG - Intergenic
1024084009 7:45878664-45878686 GGCAAATGGCTTTGTGGGCCAGG - Intergenic
1025126676 7:56350326-56350348 GGCAGATGGGTTTGTGGTTCAGG - Intergenic
1025192176 7:56904193-56904215 GACACATGGCTTTGGAGACCGGG + Intergenic
1028418419 7:90605355-90605377 GGAAAGTTGCTTTGGAGTCCAGG - Intronic
1029735950 7:102465847-102465869 GGCACAGGAGTTTGGGGTCCAGG - Exonic
1031117151 7:117680902-117680924 GGCAAATGGCTCAGGGGTTCTGG + Intronic
1031169731 7:118277536-118277558 GGAAAATGCCTTTGAGGTTCAGG + Intergenic
1032656345 7:133934660-133934682 GGCAAATGGCTTTGAAAACCAGG - Intronic
1033514015 7:142088178-142088200 GCCAACTGGCTCTGGGATCCAGG - Intronic
1033876472 7:145825045-145825067 AGCAAATGACTTTGGGGAACTGG - Intergenic
1034817334 7:154183793-154183815 GACACATGGTTTTGGAGTCCTGG - Intronic
1035641548 8:1188388-1188410 GGCAAATGTCATGGAGGTCCCGG - Intergenic
1039379384 8:37070714-37070736 AGCAAATGGCTTTGAGCTGCTGG + Intergenic
1040433431 8:47366275-47366297 GGAGTATGACTTTGGGGTCCAGG + Intronic
1040447630 8:47511692-47511714 GGCAAATGGTCTTGGTGTACTGG + Intronic
1043866564 8:85382040-85382062 GGATAATGGCTTTGAGCTCCAGG - Intronic
1044629670 8:94266260-94266282 GTCAAATGCCTTTAGGGGCCAGG - Intergenic
1049672241 8:143875095-143875117 GGCACATGGTTTTGGGACCCAGG - Intronic
1052714067 9:32093597-32093619 GGCAAATGGATTTGGAGTGGGGG - Intergenic
1054825373 9:69567770-69567792 TTCAAATGGCACTGGGGTCCGGG + Intronic
1055225526 9:73990152-73990174 GGAAAATGGTTTTGTGGTCTGGG - Intergenic
1056255580 9:84795750-84795772 GCCAAAATACTTTGGGGTCCGGG - Intronic
1056797249 9:89666944-89666966 GACTACTGGCTTTGTGGTCCAGG + Intergenic
1056842180 9:90007097-90007119 GGTGAATGGGTTTTGGGTCCTGG + Intergenic
1057285384 9:93749301-93749323 GAGAAATGGTTTTGGGGGCCAGG - Intergenic
1060515656 9:124264138-124264160 CCCAAATGGCTTTGGGGGGCGGG - Intronic
1061298287 9:129689055-129689077 GGCTCATGGCTTAGGGGTGCTGG + Intronic
1061872465 9:133528195-133528217 GGCATATGGCTGTGGGGATCTGG - Intronic
1062085527 9:134646121-134646143 GGCAAAAGCCTTCAGGGTCCAGG - Intronic
1062450526 9:136613959-136613981 GGCAAATGGCATTTGGATTCTGG + Intergenic
1189903577 X:45734476-45734498 GAAAAATGGCTTTGTGGGCCAGG + Intergenic
1192145813 X:68681746-68681768 GCCCAATGGCTTTGTGGTCAGGG + Intronic
1194315649 X:92373277-92373299 GGCAAAGGGGTTTGGGCTACAGG + Intronic
1194744034 X:97609037-97609059 GGAAGGTGGTTTTGGGGTCCAGG - Intergenic
1196697246 X:118626364-118626386 AGCAAAGGGTTTTGGGGACCGGG - Intronic
1200623699 Y:5484816-5484838 GGCAAAGGGGTTTGGGCTACAGG + Intronic
1201774260 Y:17646509-17646531 GTAAAAGGGCTTGGGGGTCCGGG - Intergenic
1201827297 Y:18259480-18259502 GTAAAAGGGCTTGGGGGTCCGGG + Intergenic