ID: 1162807973

View in Genome Browser
Species Human (GRCh38)
Location 19:13148776-13148798
Sequence CTGTTGCAGGAGAGGGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1630
Summary {0: 1, 1: 0, 2: 6, 3: 142, 4: 1481}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162807973_1162807981 -1 Left 1162807973 19:13148776-13148798 CCCCCAGCCCTCTCCTGCAACAG 0: 1
1: 0
2: 6
3: 142
4: 1481
Right 1162807981 19:13148798-13148820 GGAAACCAGTATAGACCCAGAGG 0: 1
1: 0
2: 1
3: 10
4: 136
1162807973_1162807986 22 Left 1162807973 19:13148776-13148798 CCCCCAGCCCTCTCCTGCAACAG 0: 1
1: 0
2: 6
3: 142
4: 1481
Right 1162807986 19:13148821-13148843 ACACAGTAGAGAGGAACCCACGG 0: 1
1: 0
2: 0
3: 25
4: 214
1162807973_1162807983 13 Left 1162807973 19:13148776-13148798 CCCCCAGCCCTCTCCTGCAACAG 0: 1
1: 0
2: 6
3: 142
4: 1481
Right 1162807983 19:13148812-13148834 ACCCAGAGGACACAGTAGAGAGG 0: 1
1: 0
2: 2
3: 23
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162807973 Original CRISPR CTGTTGCAGGAGAGGGCTGG GGG (reversed) Intronic
900385408 1:2408347-2408369 CTGTTGGCTGAGAGGCCTGGAGG + Intronic
900706849 1:4086296-4086318 CTGCAGCTGCAGAGGGCTGGTGG + Intergenic
900900941 1:5515421-5515443 CTGTTGGAGGCGAGGCCCGGTGG - Intergenic
901135702 1:6992805-6992827 GTGTTGCAGGAGGGGCCTGGTGG - Intronic
901196237 1:7441527-7441549 CTGGTGCAGGGGTGGGCTGCGGG + Intronic
902060521 1:13638288-13638310 CTGTTGGAGGAGGGGCCTGGTGG - Intergenic
902246090 1:15121556-15121578 TTGTTGGAGGTGAGGTCTGGTGG + Intergenic
902540829 1:17153250-17153272 GTGTTGGAGGTGCGGGCTGGTGG + Intergenic
902719006 1:18291857-18291879 CTGTGGCAGGTGACGGATGGTGG + Exonic
902800113 1:18824267-18824289 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
902901075 1:19516574-19516596 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
902927746 1:19708004-19708026 GTGTTGAAGGAGAGGCCTGGTGG - Intronic
903325027 1:22564420-22564442 CTTGGGGAGGAGAGGGCTGGGGG + Intronic
903372790 1:22847615-22847637 CTGCTGGAGGAAAGGGCTGAGGG + Intronic
903691682 1:25178528-25178550 GTGTTGCAGGTGGGGCCTGGTGG - Intergenic
904026053 1:27504484-27504506 CTTTTGCAGGAGGCGGCTGTTGG + Intergenic
904312486 1:29637981-29638003 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
904314739 1:29652929-29652951 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
905361299 1:37422779-37422801 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
905373809 1:37504036-37504058 ATGTTGAGGGAGAGAGCTGGTGG + Intronic
905753868 1:40490276-40490298 GTGTTGCAGGTGGGGCCTGGTGG - Intronic
906011467 1:42531061-42531083 ATGTTGGAGGAGTGGCCTGGTGG + Intronic
906575657 1:46886933-46886955 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
906596319 1:47080963-47080985 GTGTTGGAGGAGAGGCCTGGTGG - Intronic
906708479 1:47912071-47912093 CTCTTGGAGGAGGGGGCTGAGGG + Intronic
907073920 1:51562164-51562186 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
907390641 1:54156009-54156031 GTGTTGAAGGAGGGGCCTGGTGG - Intronic
907448538 1:54526662-54526684 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
907654181 1:56325476-56325498 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
907702972 1:56807138-56807160 CTGCAGCAGGAGAGGGCAGCAGG - Intronic
908032760 1:60019138-60019160 GTGTTGAAGGAGGGGCCTGGTGG + Intronic
908094497 1:60722336-60722358 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
908351353 1:63288433-63288455 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
908497476 1:64709089-64709111 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
908820690 1:68083208-68083230 ATGTTGGAGGTGAGGCCTGGTGG - Intergenic
908851429 1:68380654-68380676 GTGTTGAGGGAGAGGCCTGGTGG - Intergenic
908930338 1:69310669-69310691 CTCTTGCAGGGCAGGCCTGGTGG + Intergenic
909422633 1:75484014-75484036 ATGTTGGAGGAGGGGCCTGGTGG - Intronic
909422902 1:75485974-75485996 ATGTTGGAAGAGAGGCCTGGTGG - Intronic
909525071 1:76613576-76613598 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
909681592 1:78298068-78298090 CTGTTGAGGGAGTGGCCTGGTGG + Intergenic
909693645 1:78438992-78439014 GTGTTGGAGGAGAGGCCTAGTGG - Intronic
909805753 1:79872658-79872680 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
909827387 1:80143097-80143119 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
910203693 1:84725914-84725936 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
910280472 1:85495037-85495059 CAGTTCCAGCAGAGGGCAGGCGG + Intronic
910436640 1:87212119-87212141 CCCTTGCAGGACATGGCTGGAGG + Intergenic
910460511 1:87443964-87443986 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
910619870 1:89241814-89241836 CTGTTGAAGGTGGGGTCTGGTGG + Intergenic
910709951 1:90168793-90168815 CTGTTGTAGGGCAGGCCTGGTGG - Intergenic
911201986 1:95054213-95054235 GTGTTGAAGGAGGGGCCTGGTGG + Intronic
911234986 1:95403000-95403022 GTGTTGGAGGAGAGGCCTTGTGG + Intergenic
911249925 1:95563830-95563852 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
911269934 1:95788799-95788821 GTGTTGAAGGAAAGGCCTGGTGG + Intergenic
911529893 1:99031993-99032015 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
911779507 1:101858573-101858595 ATGTTGGAGGAGGGGCCTGGTGG + Intronic
911979312 1:104546060-104546082 ATGTTGGAGGAGAGGTCTGGTGG + Intergenic
912313746 1:108647936-108647958 ATATTGGAGGAGGGGGCTGGTGG + Intergenic
912410856 1:109479848-109479870 CTGCTGCAGGTGAGGGTTGGGGG + Exonic
912607770 1:111009701-111009723 CTCTTGCAAGACAGGCCTGGTGG - Intergenic
913526701 1:119700618-119700640 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
913526948 1:119702570-119702592 GTGTTGGAGGAGTGGCCTGGTGG + Intronic
915048003 1:153035185-153035207 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
915276773 1:154794444-154794466 ATCTTGCAGCAGAGGGCTGATGG - Intronic
915409946 1:155693133-155693155 GTGTTGCTGGTGAGGGCTAGAGG - Intronic
915452580 1:156016728-156016750 ATGTTGGAGGAGGGGCCTGGTGG + Intronic
916166887 1:161972819-161972841 CTGCTGGAAGAGAGGGCTAGAGG + Intergenic
916301996 1:163285655-163285677 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
916409345 1:164529979-164530001 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
916627069 1:166569944-166569966 CTCTTGTAGGAGAAGGCTGAAGG + Intergenic
916794707 1:168155009-168155031 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
916827910 1:168461202-168461224 CTCTTGCAGGGCAGGCCTGGTGG + Intergenic
917079258 1:171239323-171239345 CTCTTGCAGGGCAGGCCTGGTGG - Intergenic
917582121 1:176389896-176389918 CTCTTGCAAGGCAGGGCTGGTGG + Intergenic
917599718 1:176562042-176562064 ATGTTGCAGGAGGGACCTGGTGG - Intronic
918062538 1:181074428-181074450 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
918156423 1:181851068-181851090 TTCTTGCAGGACAGGCCTGGTGG - Intergenic
918162073 1:181910700-181910722 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
918284915 1:183042800-183042822 CAGTGCCAGGAGAGGGCTGGGGG - Intronic
918490465 1:185075775-185075797 GTGTTGGAGGAGGGGCCTGGTGG - Intronic
918614602 1:186530331-186530353 CTCTTGCAAGACAGGCCTGGTGG + Intergenic
918666526 1:187157658-187157680 CTGTTGGAGGTGGGGCCTGGTGG + Intergenic
918722827 1:187875719-187875741 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
918993457 1:191728323-191728345 GTGTTGGAGGAGTGGCCTGGTGG - Intergenic
919164306 1:193872837-193872859 CTCTTGTAGGACAGGCCTGGGGG - Intergenic
919431844 1:197503577-197503599 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
919579088 1:199349172-199349194 GTGTTGGAGGAGAGACCTGGTGG + Intergenic
919586421 1:199446326-199446348 CTCTTGCAGGGCAGGCCTGGTGG + Intergenic
919986167 1:202676882-202676904 ATGTTGAAGGAGAGGCCTGGTGG + Intronic
920271796 1:204770680-204770702 GTGTTGGAGGAGAGGTCTGGTGG - Intergenic
920273624 1:204787120-204787142 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
920298176 1:204972512-204972534 CAGAGGCTGGAGAGGGCTGGGGG - Intronic
920384059 1:205555291-205555313 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
920933315 1:210408675-210408697 CTGCTGCAGGAAAGGGATGGGGG + Intronic
921370873 1:214421942-214421964 CCAGTGCAGGAGAGGCCTGGGGG - Intronic
921745938 1:218740872-218740894 ATGTTGGAGGAGAGGCCTGGGGG + Intergenic
921922845 1:220688089-220688111 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
922069089 1:222173737-222173759 GTGTTGGAGGTGGGGGCTGGTGG - Intergenic
922229772 1:223675572-223675594 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
922381137 1:225027732-225027754 GTGTTGAAGGAGGGGTCTGGTGG - Intronic
922717575 1:227885292-227885314 CAGGTGCAGCAGAGGGCAGGCGG + Intergenic
922844251 1:228670711-228670733 GTGTTGGAGCAGAGGCCTGGTGG + Intergenic
923015839 1:230126226-230126248 CTGTGCTAGGAGAGGGCTGTAGG + Intronic
923021864 1:230170888-230170910 ATGTTGGAGGTGAGGCCTGGTGG - Intronic
923053155 1:230403106-230403128 CTGTTAGAGAAGAGGCCTGGAGG - Intronic
923297094 1:232604675-232604697 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
923417239 1:233775390-233775412 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
923706800 1:236350796-236350818 ATGGGGCAGGGGAGGGCTGGAGG - Intronic
923753253 1:236766578-236766600 CTGCTGCATGAGAGGACTTGGGG + Intergenic
924333713 1:242966128-242966150 CTGTTGCTGGACAGGCATGGGGG - Intergenic
924788764 1:247223710-247223732 CTCTTGCAAGGGAGGCCTGGTGG - Intergenic
1063094743 10:2899463-2899485 GTGTTGGAGGAGAAGTCTGGTGG - Intergenic
1063224662 10:4004486-4004508 CTGTTGAATGAGAAGGCTGAAGG + Intergenic
1063310344 10:4946088-4946110 CTGTTGGAAGAGGGGCCTGGTGG + Intronic
1063765514 10:9135901-9135923 ATGTTGTAGGTGAGGCCTGGTGG - Intergenic
1064378713 10:14820830-14820852 CTGTTGGAGGAGGGGCCTGTTGG + Intronic
1064721710 10:18235844-18235866 ATGTTGGAGGAGGGGGCTGGTGG + Intronic
1064789285 10:18937696-18937718 CTCTTGTAAGGGAGGGCTGGTGG + Intergenic
1064927068 10:20581181-20581203 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1064964648 10:21002807-21002829 GTGTTGGAGGAGGGGCCTGGTGG - Intronic
1065216998 10:23458825-23458847 ATGTTGCAGGTGAGGCCTAGTGG + Intergenic
1065349626 10:24783773-24783795 ATATTGGAGGAGAGGCCTGGTGG - Intergenic
1065364404 10:24921396-24921418 CTGTTGAAGGACCGGGATGGGGG - Intronic
1065420419 10:25537699-25537721 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
1065789719 10:29249723-29249745 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1065835402 10:29653186-29653208 ATGTTGGAGGACAGGCCTGGTGG + Intronic
1065856116 10:29831736-29831758 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1065870618 10:29953158-29953180 ATGTTGGAGGTGAGGCCTGGTGG - Intergenic
1065905511 10:30247771-30247793 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1066093412 10:32049114-32049136 CTGTTGCAGGACAGGCATGGTGG - Intronic
1066247463 10:33597295-33597317 GTGTTGGAGGCGAGGCCTGGTGG + Intergenic
1066483929 10:35825657-35825679 GTGTTGTGGGAGAGGCCTGGTGG - Intergenic
1066510908 10:36094888-36094910 GTGTTGGAGGAGGGGACTGGAGG + Intergenic
1066552488 10:36574719-36574741 GTGTTGAAGGAGAGACCTGGTGG + Intergenic
1066684388 10:37966701-37966723 ATGTTGGAGGAGGGGCCTGGTGG - Intronic
1067207420 10:44231656-44231678 CTCTTGCAGGACAGACCTGGTGG + Intergenic
1067457985 10:46437107-46437129 GTGTTGGAGGAGAGGCCTGGGGG - Intergenic
1067476628 10:46571632-46571654 ATGTTGCAGGTGGGGCCTGGTGG + Intergenic
1067618110 10:47770149-47770171 ATGTTGCAGGTGGGGCCTGGTGG - Intergenic
1067629212 10:47947527-47947549 GTGTTGGAGGAGAGGCCTGGGGG + Intergenic
1067810535 10:49423800-49423822 CTCTTGTAGGACAGGCCTGGTGG + Intergenic
1068126683 10:52849788-52849810 CTCTTGCAGGGCAAGGCTGGTGG + Intergenic
1068153277 10:53162295-53162317 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
1068781956 10:60929129-60929151 ATGTTGAAGGAGGGGCCTGGTGG - Intronic
1068889295 10:62132179-62132201 GTGTTGGAGGAGGAGGCTGGTGG + Intergenic
1068926146 10:62541293-62541315 GTGTTGGAGGTGAGGACTGGTGG + Intronic
1069128016 10:64662141-64662163 GTGTTGCAGGAGGGATCTGGTGG - Intergenic
1069239133 10:66116941-66116963 GTGTTGGAGGAGGGGCCTGGGGG - Intronic
1070224057 10:74482395-74482417 ATGTTGCAAGAGAGGCCTGGTGG - Intronic
1070433079 10:76360769-76360791 CTGTAGCAGGTGAGGGAGGGAGG - Intronic
1070510909 10:77159781-77159803 ATATGGCAGGAGAGTGCTGGGGG - Intronic
1070575883 10:77678437-77678459 ATGTTGCAGGAGGGACCTGGAGG + Intergenic
1070817728 10:79335840-79335862 TTGTTGGAGGAGATGGCTTGTGG + Intergenic
1071077025 10:81767308-81767330 CTCTTGCAGGGCAGGCCTGGTGG + Intergenic
1071189503 10:83082935-83082957 CTGTTGGAGGTGGGGCCTGGTGG + Intergenic
1071257396 10:83883827-83883849 CTGTTGGAGGTGGGGCCTGGTGG + Intergenic
1071289435 10:84177567-84177589 GTGATGCAGGAGAGGGATAGAGG + Intronic
1071348227 10:84713739-84713761 GTGTTGAAGGAGGGGCCTGGTGG + Intergenic
1071507152 10:86239565-86239587 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
1072358008 10:94631517-94631539 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1072358372 10:94634139-94634161 GTGTTGCAGGAGGGGTCTGGTGG + Intergenic
1072548705 10:96460492-96460514 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
1073898174 10:108186908-108186930 GTGTTGGAGGAGGGGTCTGGTGG + Intergenic
1073980475 10:109148013-109148035 GTGTTGGAGGAGTGGCCTGGTGG - Intergenic
1074274532 10:111988790-111988812 ATGTTGAAGGAGGGGTCTGGTGG - Intergenic
1074789128 10:116868643-116868665 CTTTTGGAGGAGAGGGCTGTGGG - Exonic
1074845973 10:117398414-117398436 ATGTTGGAGGAGGGGTCTGGTGG - Intergenic
1074981522 10:118623753-118623775 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1075172165 10:120126153-120126175 CTCTTGCAGGGCAGGCCTGGTGG + Intergenic
1075217920 10:120554858-120554880 ATGTTGGAGGAGGGGCCTGGTGG - Intronic
1076114288 10:127884741-127884763 CCGGTGGAGGAGATGGCTGGTGG - Intronic
1076257723 10:129041974-129041996 CTGTTTCAGGAAAGGGCCAGTGG - Intergenic
1076405258 10:130207978-130208000 TTGGGGCAGGAGAGGGGTGGGGG - Intergenic
1076674711 10:132141998-132142020 TTGTTGCAGGAGCAGGTTGGAGG + Exonic
1077131210 11:973677-973699 CTGGTGCAGGAGAGGGAGGGTGG + Intronic
1077259089 11:1606187-1606209 CTGTAACAGCAGAGCGCTGGAGG - Intergenic
1077316300 11:1920842-1920864 CTGTTGCGGGGAGGGGCTGGTGG - Intronic
1077564440 11:3288074-3288096 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1077570330 11:3333891-3333913 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1078914116 11:15761780-15761802 GTGTTGCAGGGCAGGGGTGGGGG - Intergenic
1078964492 11:16322218-16322240 ATGTTGGAGGAGAGGCTTGGTGG + Intronic
1078978730 11:16506669-16506691 GTGTTGGAGGAGGGAGCTGGTGG + Intronic
1079120158 11:17677236-17677258 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1079390654 11:20019195-20019217 CTGTTGCAGGAAAGAGATGATGG + Intronic
1079482034 11:20891327-20891349 CTCTTGCAGGGCAGGCCTGGTGG - Intronic
1079649989 11:22915776-22915798 CTGGTGCAGGGGTGGGATGGTGG + Intergenic
1079819483 11:25106857-25106879 TTGTTGGAGGAGGGGTCTGGTGG - Intergenic
1079966185 11:26983086-26983108 CTCTTGCAGGGCAGGCCTGGTGG + Intergenic
1079992037 11:27256379-27256401 GTGTTGGAGGAGGGGTCTGGTGG - Intergenic
1080044912 11:27798661-27798683 GGGTTGGAGGAGAGGCCTGGTGG + Intergenic
1080045076 11:27799762-27799784 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1080081204 11:28220738-28220760 CTCTTGTAGGGCAGGGCTGGTGG + Intronic
1080105488 11:28507422-28507444 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1080109151 11:28546197-28546219 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1080164691 11:29223131-29223153 CTGTTGCAGGGCAGGCCTGGTGG + Intergenic
1080173854 11:29338725-29338747 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1080484414 11:32690493-32690515 TTGTTGGAGGAGGGGCCTGGTGG + Intronic
1080843220 11:36004008-36004030 ATATTGGAGGAGAGGCCTGGTGG - Intronic
1080967644 11:37232197-37232219 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1080981480 11:37412234-37412256 ATGTTGAAGGAGGGAGCTGGTGG + Intergenic
1081016942 11:37893370-37893392 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1081068508 11:38578313-38578335 ATGTTGGAGGTGAGGCCTGGTGG - Intergenic
1081090069 11:38853637-38853659 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1081167550 11:39824289-39824311 CTGTTGAAGGTGGGGCCTGGTGG - Intergenic
1081325560 11:41739688-41739710 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1081346646 11:41995344-41995366 ATGTTGGAGGAGAGACCTGGTGG - Intergenic
1081395932 11:42586227-42586249 TTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1081441359 11:43085073-43085095 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1081485613 11:43525642-43525664 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1081485670 11:43526121-43526143 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1081558458 11:44189675-44189697 ATGTTGGAGGAGGGGCCTGGTGG - Intronic
1082147245 11:48684964-48684986 CTCTTGTAGGGGAGGCCTGGTGG - Intergenic
1082996886 11:59262156-59262178 GTGCTGCAGGCGGGGGCTGGGGG - Intergenic
1083018198 11:59478109-59478131 CTCAGGCAGGAGAGGGCAGGAGG + Exonic
1083268814 11:61560331-61560353 CTGTGGCTGAAGAGGGCTTGAGG - Intronic
1083293502 11:61702866-61702888 CTGTGGCAGGAAGGGGCTGTGGG - Intronic
1083325725 11:61872076-61872098 CTGGGGCAGGAGAGCACTGGGGG - Intergenic
1083336911 11:61927648-61927670 GTGTTGAAGGAGGGGCCTGGTGG + Intergenic
1083582093 11:63831513-63831535 CTCTTGGAGGATGGGGCTGGTGG - Intergenic
1083756050 11:64792208-64792230 CTGCAGCAGGAGCAGGCTGGTGG + Exonic
1083780917 11:64916879-64916901 CTGCGGCAGGATCGGGCTGGGGG - Intronic
1083891154 11:65596387-65596409 CTGTGGCAGGGGAGAGTTGGGGG + Intronic
1083948692 11:65941566-65941588 CTGATGCAGGAGAGAGTGGGAGG + Intergenic
1084368608 11:68721269-68721291 CTGTGGCAAGAGAGGGAGGGTGG - Intronic
1084858258 11:72002432-72002454 CTGTTCCAGGGAAGGGATGGGGG + Exonic
1084972185 11:72777930-72777952 CTGAGGCAGGAGAGGGGAGGGGG + Intronic
1085024676 11:73229566-73229588 CTGTAGAATGAGAGGGCGGGAGG + Intronic
1085066566 11:73500653-73500675 CTCTTGCAGGGCAGGCCTGGTGG - Intronic
1085176950 11:74496826-74496848 CTGCAGCAGAAGAGAGCTGGGGG - Intronic
1085563558 11:77492710-77492732 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1085818655 11:79769216-79769238 GTATTGAAGGAGGGGGCTGGTGG + Intergenic
1086237433 11:84648552-84648574 ATGTTGGAGGTGGGGGCTGGTGG + Intronic
1086250399 11:84805471-84805493 GTGTTGAAGGAGGGGCCTGGTGG + Intronic
1086365810 11:86109443-86109465 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
1086392231 11:86376612-86376634 GTGTTGAGGGAGAGGCCTGGTGG - Intronic
1086511341 11:87561363-87561385 GTGTTGGAGGAGGGGTCTGGTGG - Intergenic
1086802600 11:91195675-91195697 GTGATAAAGGAGAGGGCTGGCGG - Intergenic
1087292829 11:96339184-96339206 ATGTCTCAGGAGATGGCTGGTGG + Intronic
1087335013 11:96833190-96833212 CTGTTGTAGGAGTGAGCTGGTGG + Intergenic
1087650943 11:100866755-100866777 CTGTTGGAGGAGGGGCCTGCTGG - Intronic
1087766619 11:102162301-102162323 CTGTTGCAGAGGGAGGCTGGTGG + Intronic
1088167429 11:106955479-106955501 CTCTTGCAGGGCAGGACTGGTGG + Intronic
1088412793 11:109553871-109553893 GTGTTGAAGGAGGGGCCTGGTGG - Intergenic
1088460253 11:110075225-110075247 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
1088561213 11:111118183-111118205 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
1088844204 11:113651343-113651365 ATGTTGGAGGAGGGGTCTGGTGG - Intergenic
1089067402 11:115672363-115672385 CTGCAGAAGGAGAGGGCTTGGGG + Intergenic
1089669393 11:120043044-120043066 GTGTTGGAGGTGAGGTCTGGTGG - Intergenic
1089754100 11:120673782-120673804 CAGTTTCAGGAAAGAGCTGGAGG - Intronic
1089757076 11:120695116-120695138 CAGCAGGAGGAGAGGGCTGGGGG - Intronic
1089808106 11:121109783-121109805 GTTTTGCAGGAGAGTGCTTGAGG + Intronic
1089896533 11:121935707-121935729 CTGTTGGAGGTGGGGCCTGGAGG - Intergenic
1090032924 11:123222828-123222850 ATGTTGAAGGAGGGGCCTGGTGG + Intergenic
1090098442 11:123768183-123768205 GTGTTGAAGGAGGGGCCTGGTGG + Intergenic
1090332214 11:125941250-125941272 CTGTTGTAAGAGCGGGATGGTGG - Intergenic
1090357775 11:126151422-126151444 ATGTTGCTGGAGCGGGCAGGAGG - Intergenic
1090507117 11:127328084-127328106 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
1090756226 11:129794315-129794337 GTGTTGCAGGAGGGGGCTGGTGG - Intergenic
1090834123 11:130441504-130441526 GTGTTGCAGGTGGGGCCTGGTGG - Intergenic
1090860348 11:130647464-130647486 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1091009021 11:131981572-131981594 CTGTGGCAAGAGAGGACTGTAGG + Intronic
1092448816 12:8583169-8583191 CTGTTGGAGGTGGGGTCTGGTGG + Intergenic
1092926963 12:13280177-13280199 GTGTTGGAGGAAAGGGCTTGTGG - Intergenic
1093172958 12:15879513-15879535 CGGTTGCAGGAGAAGGCTCTGGG - Intronic
1093226043 12:16484758-16484780 GTGTTGGAGGACAGGCCTGGTGG - Intronic
1093230751 12:16539056-16539078 ATGTTGTGGGAGAGAGCTGGTGG - Intronic
1093440853 12:19194038-19194060 ATGTTGGAGGTGAGGCCTGGTGG - Intronic
1093481128 12:19604913-19604935 TTGTTGGAGGAGTGGCCTGGTGG + Intronic
1093522702 12:20068740-20068762 CTCTTGCAGGGCAGGCCTGGTGG - Intergenic
1093696390 12:22165191-22165213 ATGTTGTGGGAGAGGCCTGGTGG + Intronic
1093808663 12:23466210-23466232 CTCTTGCAGGACAGGCCTGGTGG - Intergenic
1093874165 12:24329473-24329495 ATGTTGAAGGAGAGACCTGGTGG - Intergenic
1094170506 12:27486333-27486355 GGGATGCAGGAGAAGGCTGGTGG - Intronic
1094236502 12:28173283-28173305 GTGTTGGAGGAGGGGCCTGGTGG - Intronic
1094282232 12:28753104-28753126 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
1094477572 12:30853395-30853417 CTGCTGCAGGGGAGGGGTGAGGG + Intergenic
1094660414 12:32465322-32465344 CTGTTAAAGGTGAGGGCTGGGGG - Intronic
1095320181 12:40817842-40817864 CTCTTGCAGGGCAGGCCTGGTGG + Intronic
1095382372 12:41611206-41611228 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1095509824 12:42938670-42938692 TTGTTGCAGGGAAGGGCGGGAGG - Intergenic
1095556625 12:43513905-43513927 CTGTTGCGGGTGAGGGGAGGGGG + Intronic
1095804662 12:46305352-46305374 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
1095872875 12:47050231-47050253 ATGTTGGAGGTGAGGCCTGGTGG - Intergenic
1095928971 12:47607039-47607061 GTGTTGTGGGAGAGGCCTGGTGG - Intergenic
1097312942 12:58141040-58141062 ATGTTGGAGGAGAGGTCTGGTGG + Intergenic
1097335411 12:58377345-58377367 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1097410261 12:59243774-59243796 CTCTTGCAGGGCAGGTCTGGTGG - Intergenic
1097442980 12:59633876-59633898 GTGTTGAAGGAGGGAGCTGGTGG - Intronic
1097475299 12:60047790-60047812 ATGTTGGAGGAGAGGCCTGGTGG + Intergenic
1097588591 12:61545398-61545420 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1097699577 12:62806526-62806548 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
1098166407 12:67702880-67702902 ATGCTGGAGGAGAGGCCTGGTGG + Intergenic
1098271321 12:68773012-68773034 CTGTGACTGGTGAGGGCTGGTGG - Exonic
1098298225 12:69026476-69026498 ATGTTGGAGGAGAGGCCTGGTGG + Intergenic
1098470076 12:70833088-70833110 GTGTTGGAGGTGAGGTCTGGTGG - Intronic
1098715093 12:73820642-73820664 GTGTTGAAGGAGGGGCCTGGTGG - Intergenic
1099033570 12:77559253-77559275 ATGTTGGAGGAGTGGCCTGGTGG - Intergenic
1099525167 12:83710303-83710325 GTGTTGCAGGAAAAGCCTGGTGG - Intergenic
1099559063 12:84149509-84149531 ATGTTGAAGGAGTGGCCTGGTGG + Intergenic
1099620988 12:85002765-85002787 ATGTTGTAGGAGAGGCCTAGCGG + Intergenic
1099807742 12:87541990-87542012 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
1099833133 12:87871246-87871268 GTATTGCAGCAGAGGGCTGCTGG - Intergenic
1099898867 12:88682371-88682393 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
1099972432 12:89514109-89514131 GTGTTGGAGGAGGGGCCTGGAGG + Intronic
1099974104 12:89528476-89528498 GTGTTGGAGGAGGGGGCTGGTGG + Intergenic
1100030642 12:90186164-90186186 ATGTTGAAGGAGAAGCCTGGGGG - Intergenic
1100156601 12:91806426-91806448 CTTTTGCAAGGGAGGTCTGGTGG - Intergenic
1100437387 12:94584138-94584160 GTGTTGGAGGTGAGGCCTGGTGG + Intronic
1100532667 12:95474509-95474531 CTGTGGGACTAGAGGGCTGGTGG + Intronic
1101076935 12:101140036-101140058 CTGTTGGAGAAGAGGCCTGCTGG - Intergenic
1101228064 12:102709633-102709655 ATGTTGGAGGTGGGGGCTGGTGG - Intergenic
1101571047 12:105954018-105954040 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1102094040 12:110220983-110221005 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1102738823 12:115187788-115187810 ATGTTGGAGGAGGGGCCTGGCGG + Intergenic
1103049609 12:117767963-117767985 CTGCTGCAGCTGAGGGCTTGTGG + Intronic
1103327818 12:120133175-120133197 GTGTTGCAGGTGTGGGCAGGAGG + Intronic
1103524766 12:121560464-121560486 CTGATGCAGGAGGTGGGTGGGGG + Intronic
1103995435 12:124826940-124826962 CAATCTCAGGAGAGGGCTGGGGG + Intronic
1104256187 12:127141474-127141496 CTCTTGCAGGACAGGCCTGGTGG + Intergenic
1104260083 12:127174216-127174238 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1104370850 12:128222775-128222797 ATGTTGGAGGTGAGGCCTGGTGG - Intergenic
1104768728 12:131346718-131346740 CTGTTGCAGGAGCAGGACGGAGG + Intergenic
1104958645 12:132477829-132477851 GTGGGGCAGGAGAGTGCTGGGGG - Intergenic
1105258294 13:18759721-18759743 CTGTTGTAGGTGGGGCCTGGTGG - Intergenic
1105258750 13:18763124-18763146 ATGTTGCAGGTGGGGCCTGGTGG - Intergenic
1105260951 13:18779021-18779043 CTGTTGTAGGTGGGGCCTGGTGG - Intergenic
1105261420 13:18782427-18782449 ATGTTGCAGGTGGGGCCTGGTGG - Intergenic
1105263767 13:18799005-18799027 ATGTTGCAGGTGGGGCCTGGTGG - Intergenic
1105569734 13:21590408-21590430 CTCTTGCAGGGCAGGCCTGGTGG - Intronic
1105712524 13:23026315-23026337 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1106077914 13:26476568-26476590 CTGATGGAGGAGAGGGCTGTTGG - Intergenic
1106417962 13:29561637-29561659 CTGTTCAAGGAGAGTGATGGAGG + Intronic
1106587878 13:31072917-31072939 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1106608283 13:31252183-31252205 CTCTTGCAGGGCAGGCCTGGTGG - Intronic
1106894134 13:34279865-34279887 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1106960476 13:34991561-34991583 GTGTTGGAGGAGGGGCCTGGTGG - Intronic
1107226207 13:38050650-38050672 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1107336575 13:39362153-39362175 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
1107447663 13:40482897-40482919 CTGTTGGGGGAGGGGCCTGGTGG - Intergenic
1107498670 13:40954305-40954327 ATGTTGGAGGAGGGGCCTGGTGG + Intronic
1107677604 13:42813014-42813036 GTGTTGGAGGAGGGGTCTGGTGG + Intergenic
1107872809 13:44762576-44762598 ATGTTGGAGGTGAGGCCTGGTGG - Intergenic
1108527944 13:51301712-51301734 ATGTTGGAGGTGAGGCCTGGCGG - Intergenic
1108612542 13:52097876-52097898 ATGTTGGAGGAGGGGCCTGGTGG + Intronic
1108802887 13:54121169-54121191 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1108910838 13:55549862-55549884 AAGTTGTAGGAGAGGCCTGGTGG + Intergenic
1109009600 13:56923307-56923329 ATGTTGGAGGTGAGGCCTGGTGG - Intergenic
1109067961 13:57724885-57724907 CTCTTGGAGGAGAGGGCTCAGGG - Exonic
1109159018 13:58949085-58949107 GTGTTGGAGGAGGGGTCTGGTGG - Intergenic
1109174402 13:59136973-59136995 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1109384684 13:61611008-61611030 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1109404302 13:61877573-61877595 GTGTTGCAGGAGAGAGTTGGAGG + Intergenic
1109613001 13:64791289-64791311 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1109954660 13:69549914-69549936 GTGTTGGAGGACAGGGCTGGTGG - Intergenic
1110044800 13:70814107-70814129 GTGTTGTGGGAGAGGCCTGGTGG - Intergenic
1110360689 13:74621435-74621457 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
1110377974 13:74815218-74815240 ATGTTGCTGGAGAGACCTGGAGG + Intergenic
1110379939 13:74839049-74839071 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1110512373 13:76366185-76366207 TTGTTGGAGGTGAGGCCTGGTGG + Intergenic
1110542072 13:76718037-76718059 CTGTTGGAGGTGAAGCCTGGTGG - Intergenic
1110666994 13:78128445-78128467 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1110765989 13:79279873-79279895 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1110824923 13:79960388-79960410 CTCTTGCAAGACAGGCCTGGTGG - Intergenic
1110906711 13:80898581-80898603 CTATTACAGAAGAAGGCTGGGGG + Intergenic
1110907382 13:80909060-80909082 GTGTTGAAGGAGGGGCCTGGTGG + Intergenic
1110981111 13:81899537-81899559 CTGTTGTGGGAGAGATCTGGTGG - Intergenic
1111056275 13:82954619-82954641 CTCTTGCAAGACAGGCCTGGTGG - Intergenic
1111083617 13:83343772-83343794 GTGTTGCAGGAGGGACCTGGTGG + Intergenic
1111092385 13:83463782-83463804 CTCTTGCAGGGCAGGCCTGGTGG - Intergenic
1111179307 13:84641011-84641033 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1111291635 13:86178584-86178606 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
1111333750 13:86793503-86793525 CTGTTGGAGGTGAGGCCTAGTGG - Intergenic
1111447890 13:88373885-88373907 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1111490189 13:88962095-88962117 GTGTTGTAGGAGAGACCTGGTGG - Intergenic
1111659763 13:91194286-91194308 GTGTTGGAGGTGAGGCCTGGCGG + Intergenic
1112368212 13:98773509-98773531 CTGTTGCAGGAAAGGGACGCCGG - Intergenic
1112400871 13:99077274-99077296 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
1112441241 13:99426436-99426458 CAGTGGCAGGAGAGGGGTGCAGG - Intergenic
1112584723 13:100708241-100708263 GTGTTGGAGGAGTGGCCTGGTGG + Intergenic
1112795656 13:103054079-103054101 CTGTTGGAGGAGGGGCCTGGTGG + Intronic
1112930667 13:104732399-104732421 GTGTTGGAAGAGAGGCCTGGTGG + Intergenic
1113203229 13:107889355-107889377 GTGTTGATGGAGAGGCCTGGTGG - Intergenic
1113320512 13:109228203-109228225 ATGTTGGAGGTGAGGCCTGGTGG - Intergenic
1113369869 13:109713968-109713990 CTGTTGGAAGAGGGGCCTGGTGG - Intergenic
1113391823 13:109905127-109905149 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1113496472 13:110733895-110733917 TTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1113661274 13:112107854-112107876 CGGGTGCAGGAGAGGCCTTGGGG - Intergenic
1113711965 13:112471336-112471358 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1113835387 13:113325511-113325533 CAGATGCAGGACAGAGCTGGAGG + Exonic
1113935153 13:113989954-113989976 GTGTTGGAGGAGGGGCCTGGAGG + Intronic
1114274758 14:21132738-21132760 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1114347278 14:21809230-21809252 GTGTTGCAGGTGGGGCCTGGTGG + Intergenic
1114365258 14:22019737-22019759 GTGTTGGAGGAGAAGTCTGGTGG + Intergenic
1114638365 14:24201883-24201905 ATGTTGGAGGAGGGGCCTGGTGG - Intronic
1114689263 14:24564984-24565006 ATGTTGCAGATGGGGGCTGGTGG - Intergenic
1115007017 14:28498457-28498479 CTGTTGTGGGAGAGACCTGGTGG - Intergenic
1115806322 14:37055922-37055944 GTGTTGGAGGTGAGGCCTGGTGG + Intronic
1115880634 14:37913783-37913805 CTGTTGGAGGTGGGGCCTGGTGG + Intronic
1116239526 14:42323373-42323395 CTATTGCAGGAGATAGCTGATGG - Intergenic
1116495498 14:45554932-45554954 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1116549112 14:46211563-46211585 GTGTTGAAGGAGGGGCCTGGTGG + Intergenic
1116764320 14:49051791-49051813 TTGTGGCAGAAGAGGGCTGGAGG - Intergenic
1116977606 14:51133134-51133156 CTCTTGCAGGGCAGGCCTGGTGG - Intergenic
1117150574 14:52883705-52883727 ATGTTGGAGGAGGGGCCTGGTGG + Intronic
1117217355 14:53565225-53565247 GTGTTGAAGGAGGGGCCTGGTGG - Intergenic
1117857322 14:60049431-60049453 CTGTTGCAAGGCAGGCCTGGTGG + Intronic
1118368506 14:65115916-65115938 ATGCTGGAGGAGGGGGCTGGTGG - Intergenic
1119037922 14:71246236-71246258 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1119208329 14:72811222-72811244 ATGTTGGAGGTGAGGCCTGGTGG - Intronic
1119369834 14:74130117-74130139 GTGTTGTAGGAGAGACCTGGTGG - Intronic
1119665194 14:76480367-76480389 CTGGGGCAGCAGAGGGGTGGGGG + Intronic
1120101677 14:80451529-80451551 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
1120172114 14:81256653-81256675 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1120577998 14:86207889-86207911 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1120691555 14:87598772-87598794 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1120802752 14:88711262-88711284 GTGTTGAAGGAGAGACCTGGTGG + Intronic
1121030663 14:90656003-90656025 CGGTTCCAGGAGTGGGCAGGCGG - Intronic
1121627389 14:95396043-95396065 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
1121894953 14:97638179-97638201 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1121978166 14:98425691-98425713 CTGTTGCAGGAGAAGAATGAAGG - Intergenic
1122025751 14:98874646-98874668 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1122035551 14:98946703-98946725 CTTGTGCAGGAGTGGGGTGGGGG - Intergenic
1122039858 14:98979435-98979457 GTGTTGGAGGAGGGGTCTGGTGG + Intergenic
1122289419 14:100672186-100672208 CTGTGGCACAAGAGGGCAGGAGG - Intergenic
1122308250 14:100779021-100779043 CTGTGGTAGGAGAGGGAGGGAGG - Intergenic
1122804112 14:104248046-104248068 GGGGTGCTGGAGAGGGCTGGGGG + Intergenic
1122860138 14:104578867-104578889 CTGTTTCAGGGGACTGCTGGAGG - Intronic
1122993765 14:105251438-105251460 CTGTTGCAGGAGTGGACTATAGG + Intronic
1123037821 14:105478562-105478584 CTGGCGCTGGGGAGGGCTGGGGG + Intronic
1123788140 15:23692782-23692804 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1123826888 15:24091608-24091630 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1123841491 15:24252473-24252495 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1123841840 15:24255107-24255129 ATGTTACAGGAGGGGCCTGGTGG - Intergenic
1123851728 15:24363703-24363725 ATGTTACAGGAGGGGCCTGGTGG - Intergenic
1123856273 15:24415438-24415460 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1123861217 15:24468563-24468585 ATGTTACAGGAGGGGCCTGGTGG - Intergenic
1123872241 15:24588726-24588748 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1124051104 15:26198226-26198248 GTGTTGGAGGTGGGGGCTGGGGG - Intergenic
1124060895 15:26292880-26292902 CACATGCTGGAGAGGGCTGGTGG - Intergenic
1124091402 15:26606102-26606124 GTGTTGGAGGAGGGGCCTGGTGG - Intronic
1124172125 15:27385045-27385067 CTGCTGCATGAAAGGGCAGGAGG - Intronic
1124451284 15:29793734-29793756 GTGTTGGAGGAGGGGCCTGGTGG - Intronic
1124635190 15:31360589-31360611 CTGCTGCAGGAGAGGTCTGGGGG + Intronic
1125049413 15:35279459-35279481 GTGTTACAGGAGGGGCCTGGTGG + Intronic
1125281599 15:38047670-38047692 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1125891210 15:43268587-43268609 CTGCAGCAGGTGAGGGGTGGTGG - Intergenic
1126210942 15:46099554-46099576 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
1126324863 15:47465545-47465567 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
1126433835 15:48615147-48615169 CTGTTGCTGGAGAAGGTTTGAGG - Intronic
1126593392 15:50361780-50361802 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
1126595678 15:50382443-50382465 GTGTTGGAGGAGGGGCCTGGCGG + Intergenic
1126814587 15:52442260-52442282 CTGCTCCAGGAGATGGCTGGTGG - Intronic
1126876805 15:53051605-53051627 CTCTTGCAAGACAGGCCTGGTGG - Intergenic
1126899947 15:53304693-53304715 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1127760745 15:62137042-62137064 CTCTTGCAGCTGTGGGCTGGAGG - Intergenic
1127882739 15:63172487-63172509 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
1128107574 15:65055898-65055920 CAGAGGCAGGAGAGGGCAGGGGG + Intronic
1128144816 15:65327201-65327223 CTGGGGCAGGAGGGGGCTGGGGG - Exonic
1128214710 15:65926298-65926320 CTGTGGCATGAGAAGGTTGGTGG + Intronic
1128252770 15:66174487-66174509 ATGTTACAGGAGAGGCCAGGAGG - Intronic
1128345139 15:66848675-66848697 GGTTTACAGGAGAGGGCTGGAGG + Intergenic
1128394443 15:67209897-67209919 CTGATTCAGGAGATGGCTTGAGG - Intronic
1128409423 15:67379584-67379606 ATGTTGGAGGAGGGGCCTGGTGG + Intronic
1129087036 15:73104933-73104955 GTGTTGGAGGTGAGGCCTGGTGG - Intronic
1129278508 15:74464298-74464320 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
1129314650 15:74734140-74734162 ATGTTGGAGGTGGGGGCTGGTGG + Intergenic
1129477274 15:75794603-75794625 CTGTTGCAGCAGAGTGAGGGTGG - Intergenic
1129503931 15:76065308-76065330 CTGTTTCAGTAGAGGGGTGGGGG - Intronic
1129548631 15:76424794-76424816 CTCTTGTAGGGGAGGCCTGGTGG + Intronic
1129698399 15:77753716-77753738 CTGAGGGAGGAGAGGGCTGGAGG + Intronic
1129715233 15:77844239-77844261 CTGTTGGAGAAGAGGCCTGGTGG + Intergenic
1129827643 15:78645101-78645123 CTGATGAAGGAGGTGGCTGGGGG - Intronic
1129941388 15:79500135-79500157 GTGTTGGAGGAGGGGACTGGTGG + Intergenic
1130645981 15:85727508-85727530 CAGTTGCAGAAGACTGCTGGTGG + Intronic
1130840922 15:87700706-87700728 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
1131261597 15:90890709-90890731 CTGCTTCAGGAGCGGGTTGGGGG + Intronic
1131546003 15:93316002-93316024 ATGTTGTAGGAGGGGCCTGGTGG + Intergenic
1131902924 15:97108366-97108388 CTGTTGCAAGGCAGGCCTGGTGG - Intergenic
1132210495 15:100018415-100018437 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
1132261151 15:100425842-100425864 ATGTTGGAGGAGGGGCCTGGTGG + Intronic
1132302206 15:100782932-100782954 CTGGTACAGGAGAGGGGAGGAGG + Intergenic
1132310638 15:100854981-100855003 GTGTTGGTGGAGAGGGTTGGAGG - Intergenic
1132311424 15:100860678-100860700 TTGGTTCAGGAGTGGGCTGGGGG + Intergenic
1132413592 15:101604442-101604464 CAGTAGCCGGAGAGGACTGGGGG - Intergenic
1132532258 16:458274-458296 CTGTTTCAGGAAAAGGATGGGGG - Intronic
1132568394 16:633537-633559 CTGCTGCAGCAGCGGGCTGTAGG - Exonic
1132665769 16:1080690-1080712 CTGGTGCAGAGGAGAGCTGGGGG + Intergenic
1132905986 16:2283071-2283093 CTGGTGCAGGAGCTGCCTGGTGG + Intronic
1133280307 16:4661377-4661399 CTCCTCCGGGAGAGGGCTGGAGG - Intronic
1133293932 16:4740798-4740820 CTGTCTCAGTAGAGGGGTGGAGG + Intronic
1133508759 16:6437866-6437888 ATGTTGGAGGAGGGAGCTGGTGG - Intronic
1133815458 16:9194121-9194143 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1133817478 16:9209221-9209243 CTGTGGAAGGAGACGCCTGGAGG + Intergenic
1134340191 16:13337712-13337734 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1134572605 16:15304088-15304110 GTGTTGGAGGAGGGGCCTGGGGG + Intergenic
1134605039 16:15563802-15563824 GTGTTGGAGGAGGGGCCTGGGGG - Intronic
1134729777 16:16451935-16451957 GTGTTGGAGGAGGGGCCTGGGGG - Intergenic
1134914490 16:18058532-18058554 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
1134937654 16:18259961-18259983 GTGTTGGAGGAGGGGCCTGGGGG + Intergenic
1135053019 16:19207636-19207658 ATGTTGGAGGTGAGGCCTGGTGG - Intronic
1135098712 16:19587214-19587236 GTGTTGGAGGAAAGGGCTGGTGG - Intronic
1135380848 16:21995073-21995095 GTGTTGGAGGAGGGGCCTGGGGG + Intronic
1135676187 16:24417067-24417089 CTGATCCAGGACAGGCCTGGTGG + Intergenic
1135681995 16:24465370-24465392 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
1135923665 16:26673412-26673434 GTGTTGCAGGTGGGGCCTGGTGG + Intergenic
1136594023 16:31234615-31234637 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1136607689 16:31347616-31347638 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1137570078 16:49559472-49559494 CTGCAGCAGGAGAGAGTTGGAGG - Intronic
1138028495 16:53540659-53540681 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1138133574 16:54502252-54502274 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1138216249 16:55207612-55207634 CTGTAGCAGGAAGGGGGTGGGGG + Intergenic
1138391175 16:56670754-56670776 CTTTTTCAGGAGACGACTGGTGG - Intronic
1138510123 16:57503917-57503939 CCCTTGCAGGACAGGGCTGGAGG - Intergenic
1138605850 16:58088324-58088346 CAGCTGGAGGAGAGGGGTGGAGG - Intergenic
1138614826 16:58157117-58157139 CTGAGGCAGGAGAGGGGTCGAGG - Intergenic
1139169455 16:64613733-64613755 CTCTTGCAGGGCAGGGCTGGTGG + Intergenic
1139195842 16:64917749-64917771 GTGTTGCAGGAGGGGCCTGGTGG - Intergenic
1139351533 16:66339288-66339310 GTGTTGGAGGTGAGGCCTGGCGG + Intergenic
1139644642 16:68319405-68319427 CAGCTGCAGGAGTGAGCTGGTGG + Intronic
1139760754 16:69182963-69182985 TTGATTTAGGAGAGGGCTGGAGG + Intronic
1139831456 16:69801643-69801665 CTGAGGCAGGAGATGGCTTGAGG - Intronic
1140026184 16:71292413-71292435 ATGTTGTGGGAGAGAGCTGGTGG - Intergenic
1140227852 16:73093149-73093171 CTGCTGGAGGTGAGGGCTCGTGG - Intergenic
1140242531 16:73216414-73216436 CTGTTGCAGCAGATCACTGGTGG - Intergenic
1140608532 16:76570392-76570414 ATGTTGGAGGTGAGGCCTGGTGG + Intronic
1140742314 16:77952461-77952483 CAGATGCAGGCGAGGGGTGGTGG - Intronic
1141471209 16:84239885-84239907 CAGCTGCAGGAGAGCCCTGGGGG + Intergenic
1141671286 16:85493075-85493097 ATGTTGGAGCAGAGGCCTGGAGG + Intergenic
1141728236 16:85804772-85804794 CAGTTGCAGGAGTGTGGTGGAGG - Intronic
1141938879 16:87261166-87261188 GTGTTGGAGGAGAGGCCTGATGG - Intronic
1141956594 16:87376079-87376101 CTGTGGCAGTGGAGGGCAGGGGG - Intronic
1142034669 16:87855712-87855734 GTGTTGGAGGAGAGGGGTGGGGG + Intronic
1142188731 16:88707202-88707224 CTTCTGCAGGTGAGGCCTGGAGG + Exonic
1142281055 16:89147689-89147711 CTGTTGGAGGAGCGACCTGGTGG - Intronic
1142534695 17:606059-606081 GTGTTCCAGGAAAGGGCTGATGG + Intronic
1143056567 17:4167008-4167030 CTGCTGTTGGAGAGTGCTGGAGG - Exonic
1143780086 17:9224761-9224783 CTGCTGCAAGACAAGGCTGGAGG + Intronic
1144118514 17:12126118-12126140 GTGTTGAAGGAGCGGCCTGGTGG - Intronic
1144254514 17:13453414-13453436 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1144343604 17:14331305-14331327 CTGTTCCTGGAAGGGGCTGGGGG - Intronic
1144388806 17:14774456-14774478 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1144630202 17:16867698-16867720 TTGTTACAGGGAAGGGCTGGAGG - Intergenic
1144651173 17:17008098-17008120 TTGTTACAGGGAAGGGCTGGAGG + Intergenic
1144959831 17:19038834-19038856 CTGTTGCGGGACGGAGCTGGGGG - Intronic
1144975329 17:19135690-19135712 CTGTTGCGGGACGGAGCTGGGGG + Intronic
1145022712 17:19444058-19444080 ATGTTGGAGGAGGGGCCTGGGGG + Intergenic
1145783804 17:27581296-27581318 ATGTTGGAGGTGGGGGCTGGTGG - Intronic
1146391903 17:32430520-32430542 GTGTTGAAGGAGGGGCCTGGTGG + Intergenic
1146918843 17:36696281-36696303 CTGTTGCAGGGATGGGATGGGGG + Intergenic
1146921900 17:36718911-36718933 ATGTTGAAGGAGGGGCCTGGTGG + Intergenic
1148151584 17:45399638-45399660 CCTTTGCAGGGGAGGGCTAGGGG - Intronic
1148158681 17:45437643-45437665 CTCCTGCAGCAGAGGGGTGGGGG + Exonic
1148660594 17:49328464-49328486 ATGTTGGAGGTGAGGCCTGGTGG + Intronic
1148748986 17:49934105-49934127 CTGGGGCAGGAGAGGCCTTGGGG - Intergenic
1148897635 17:50849033-50849055 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
1148976794 17:51536780-51536802 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1149149005 17:53536521-53536543 CTGTTTCTGGTGAGGGCTGCAGG - Intergenic
1149201196 17:54187903-54187925 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1149342548 17:55701476-55701498 GTGTTGGAGGAGAGACCTGGTGG - Intergenic
1149696728 17:58621975-58621997 CTGTTGAAGGAGGGAGTTGGAGG - Intronic
1150293888 17:63997976-63997998 CTTTTGCAGGAGCAGGCTGGGGG - Intergenic
1150329629 17:64284483-64284505 GTGTTGGAGGCGAGGCCTGGTGG - Intergenic
1150390102 17:64785042-64785064 CTCCTGCAGCAGAGGGGTGGGGG + Intergenic
1150813144 17:68372631-68372653 GTGTTGGAGGAGGGGCCTGGTGG - Intronic
1150928879 17:69563257-69563279 CTGTTGTAGGAGGGACCTGGTGG + Intergenic
1151045795 17:70918087-70918109 ATGTTGGAGGAGAGGCCTTGTGG + Intergenic
1151373510 17:73666174-73666196 GTGTTGGAGGAGAAGCCTGGTGG + Intergenic
1151403361 17:73870826-73870848 CTGTTGGAGAAGATGGCTGCAGG + Intergenic
1151432743 17:74075279-74075301 ATGTTTGAGGAGAGGCCTGGTGG - Intergenic
1151593293 17:75061199-75061221 CTGTGGTAGGATGGGGCTGGGGG - Intronic
1151874821 17:76861678-76861700 CTGTTGGAGGAGGAGCCTGGTGG - Intergenic
1151934832 17:77255302-77255324 TGGTTGCAGGACAGGCCTGGAGG - Intergenic
1152040877 17:77901882-77901904 TGGGTGCAGGAGTGGGCTGGGGG + Intergenic
1152326373 17:79641730-79641752 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
1152375760 17:79918249-79918271 GTGCTGAAGGAGAGGGGTGGAGG - Intergenic
1152821275 17:82439095-82439117 CTGTCCCAAGCGAGGGCTGGGGG - Intronic
1153398998 18:4661669-4661691 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
1153439314 18:5099487-5099509 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1153583016 18:6594358-6594380 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
1153828015 18:8895165-8895187 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1153882460 18:9433312-9433334 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
1154424603 18:14262382-14262404 ATGTTGCAGGTGGGGCCTGGTGG + Intergenic
1154425068 18:14265783-14265805 CTGTTGTAGGTGGGGCCTGGTGG + Intergenic
1154432752 18:14321010-14321032 CTGTTGTAGGTGGGGCCTGGTGG + Intergenic
1155071774 18:22323149-22323171 CAGGAGGAGGAGAGGGCTGGGGG + Intergenic
1155306223 18:24481472-24481494 ATGTTGGAGGAGAGGCCTGGTGG - Intergenic
1155688116 18:28580709-28580731 ATGTTGCAGGTGGGGCCTGGTGG - Intergenic
1155707706 18:28837421-28837443 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1155740108 18:29278959-29278981 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
1155812722 18:30258784-30258806 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
1156016867 18:32556298-32556320 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1156643555 18:39131741-39131763 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
1156695013 18:39755324-39755346 CTCTTGCAAGGCAGGGCTGGTGG - Intergenic
1156950122 18:42885660-42885682 CTATTAGAGGAGAGGGTTGGTGG + Intronic
1156995729 18:43464968-43464990 ATGTTGGAGGAGAGGCCTGGTGG - Intergenic
1156995968 18:43466961-43466983 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1157110250 18:44813901-44813923 GAGTTGTAGGAGAGTGCTGGAGG + Intronic
1157188652 18:45561684-45561706 TTGTTGCTGGAGAGGGAGGGAGG - Intronic
1157193125 18:45597786-45597808 CTAATCCAGGAGAGGGATGGTGG + Intronic
1157499035 18:48177293-48177315 CTTTTGCAGGTGAGGGCAAGTGG - Intronic
1157536249 18:48460050-48460072 ATGTTGTAGGAGGGGCCTGGTGG + Intergenic
1157665145 18:49479742-49479764 CCATAGCAGGAGATGGCTGGAGG - Intronic
1157893212 18:51438635-51438657 CAGAGGCAGGAGAGGGCAGGAGG + Intergenic
1157907510 18:51582760-51582782 CTGTTGGAGAAGGAGGCTGGAGG + Intergenic
1158140473 18:54250217-54250239 GTGTTGCAGGAGGGACCTGGTGG + Intergenic
1158149179 18:54347906-54347928 GTGTTGTAGGAGAGACCTGGTGG + Intronic
1158317814 18:56230887-56230909 ATGTTGGAGGTGAGGCCTGGAGG + Intergenic
1158328709 18:56338075-56338097 GTGTTCCAGGAGAGAGCAGGAGG - Intergenic
1158884666 18:61815839-61815861 CTGTGGCTGAAGAGGGCTGCAGG - Exonic
1158892549 18:61886603-61886625 TTAGTGCAGGAGAGGGTTGGGGG - Intronic
1159131255 18:64282188-64282210 CTGTTGTGGGAGAGAACTGGTGG + Intergenic
1159155815 18:64580100-64580122 CTCTTGCAGGGCAGGCCTGGTGG - Intergenic
1159522792 18:69547518-69547540 CTGTTGGAGGTGAGGCCTGCTGG - Intronic
1159676056 18:71285698-71285720 CTGTTACAGGAGAGGGGTCCTGG + Intergenic
1159777737 18:72623202-72623224 GTGTTGAAGGAGGGGACTGGTGG - Intronic
1159918946 18:74210226-74210248 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1160006750 18:75073923-75073945 GTGTTGAGGGAGAGGCCTGGTGG + Intergenic
1160010325 18:75102439-75102461 GTGTTGGAGGTGGGGGCTGGTGG - Intergenic
1160095502 18:75868347-75868369 CTTTTGAAGGACAGGGTTGGAGG + Intergenic
1160271479 18:77388781-77388803 CTGTTGCAGTAGAGGCCAGAAGG - Intergenic
1160596566 18:79979393-79979415 GCGTTGCAGGTGAGGCCTGGTGG + Intronic
1160625992 18:80205457-80205479 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
1160765602 19:806218-806240 CTGGTGCAGGAGCCGGCGGGTGG + Intronic
1160768441 19:819575-819597 CTGTTGCAGGACGGGCATGGTGG - Intronic
1160866717 19:1259482-1259504 CTGTGGCTGGGGAGAGCTGGTGG - Exonic
1161022379 19:2016106-2016128 CTGTTGCAGGGGAGGGGACGGGG + Intronic
1161741766 19:6025248-6025270 CTGTAGCAGGATGGGACTGGGGG - Intronic
1162079876 19:8211388-8211410 AAGTGGCAGGACAGGGCTGGGGG - Intronic
1162255822 19:9488806-9488828 GTGTTGGAGGTGAGGTCTGGTGG + Intronic
1162807973 19:13148776-13148798 CTGTTGCAGGAGAGGGCTGGGGG - Intronic
1163173202 19:15547309-15547331 CTGCTGCAGGACAGGTGTGGTGG - Intronic
1163267973 19:16233086-16233108 CCGTGGCAGGGGAGGGCTGCTGG - Intronic
1163309357 19:16503905-16503927 CTGTTGGAGGCTAGGCCTGGTGG + Intronic
1164439680 19:28264009-28264031 GTGTTGGAGGAGAGAGATGGTGG - Intergenic
1164451700 19:28371768-28371790 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
1164453659 19:28388706-28388728 ATGTTGGAGGTGGGGGCTGGTGG + Intergenic
1164569856 19:29366027-29366049 CTGTGTCAGCAGAGGGCAGGGGG - Intergenic
1164580256 19:29430339-29430361 GTGTTGCAGGTGAGGCCTGGTGG + Intergenic
1164826165 19:31286576-31286598 GGGTTGCAGCAGAGGGCTTGGGG - Intronic
1165004785 19:32795962-32795984 GTGTTGGAGGTGGGGGCTGGTGG - Intronic
1165155880 19:33787199-33787221 GTGTTGGAGGGGAGGCCTGGTGG + Intergenic
1165843294 19:38802270-38802292 CTGAGGGAGGAGGGGGCTGGGGG + Intronic
1166296708 19:41893417-41893439 CTGAGGGAGGAGGGGGCTGGGGG + Intronic
1166296724 19:41893456-41893478 CTGAGGGAGGAGGGGGCTGGGGG + Intronic
1166296741 19:41893495-41893517 CTGAGGGAGGAGGGGGCTGGGGG + Intronic
1166296773 19:41893572-41893594 CTGAGGGAGGAGGGGGCTGGGGG + Intronic
1166296789 19:41893610-41893632 CTGAGGGAGGAGGGGGCTGGGGG + Intronic
1166296834 19:41893725-41893747 CTGAGGGAGGAGGGGGCTGGGGG + Intronic
1166296851 19:41893764-41893786 CTGAGGGAGGAGGGGGCTGGGGG + Intronic
1166296867 19:41893803-41893825 CTGAGGGAGGAGGGGGCTGGGGG + Intronic
1166296898 19:41893879-41893901 CTGAGGGAGGAGGGGGCTGGGGG + Intronic
1166296914 19:41893917-41893939 CTGAGGGAGGAGGGGGCTGGGGG + Intronic
1166545938 19:43635054-43635076 CTGAAGGAGGAGGGGGCTGGAGG - Intronic
1166560268 19:43728184-43728206 CTGTTGGAGGTGGGGCCTGGCGG + Exonic
1166571847 19:43802163-43802185 CTGAGGGAGGAGGGGGCTGGGGG - Intronic
1166836645 19:45671278-45671300 CCGTTACAGGCGAGGCCTGGGGG - Exonic
1167101413 19:47406451-47406473 CTGATGCAGGAGAGGTGTGAGGG - Exonic
1167104299 19:47421220-47421242 CAGGTGCAGGACAGGGCTAGAGG - Intergenic
1167286089 19:48599600-48599622 CTGAGGGAGGAGGGGGCTGGGGG + Intergenic
1167286115 19:48599675-48599697 CTGAGGGAGGAGAGGGCTGGGGG + Intergenic
1167312912 19:48747367-48747389 CAGTGGGAGGAGAGGACTGGGGG + Intergenic
1167333885 19:48872967-48872989 CTGAAGAAAGAGAGGGCTGGGGG + Intronic
1167413359 19:49357691-49357713 GTGTTGGAGGTGAGGCCTGGTGG + Intronic
1167489254 19:49782247-49782269 CTGAGGGAGGAGGGGGCTGGGGG + Intronic
1167492301 19:49799802-49799824 CTGAGGCAGGAGGTGGCTGGGGG + Intronic
1167557759 19:50206281-50206303 CTGGGGAAGGAAAGGGCTGGGGG + Intronic
1167693268 19:51000301-51000323 CTGAAGGAGGAGGGGGCTGGGGG - Intronic
1167708872 19:51098374-51098396 CTGAGGGAGGAGGGGGCTGGGGG - Exonic
1167738207 19:51310424-51310446 CTGAGGGAGGAGGGGGCTGGGGG + Intergenic
1167781568 19:51601910-51601932 CTGAGGGAGGAGGGGGCTGGGGG + Intergenic
1168252358 19:55147881-55147903 CTGAGGGAGGAGCGGGCTGGGGG + Intronic
1168374381 19:55863592-55863614 GTGTTGGAGGAGGGGCCTGGGGG - Intronic
925009095 2:468452-468474 CTGTTGCAGGAGGATGCGGGAGG - Intergenic
925354265 2:3226751-3226773 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
925388118 2:3477109-3477131 CTGTGGCAGAGGAGGCCTGGGGG - Intronic
925437074 2:3847727-3847749 GTGTTGGAGGAGGGGGCCGGTGG + Intergenic
925442122 2:3897631-3897653 CTCTTGCAAGGGAGGCCTGGTGG + Intergenic
925447295 2:3939047-3939069 CTGTTGCAGGGAAGTCCTGGTGG + Intergenic
925533934 2:4895357-4895379 GTGTTGGAGGCGGGGGCTGGTGG - Intergenic
925672986 2:6331682-6331704 CTCTTGCAGGGCAGGCCTGGTGG + Intergenic
925882156 2:8362002-8362024 GTGTTGCAGGTGGGGCCTGGTGG + Intergenic
925929340 2:8694266-8694288 CTGGTGGGGGAGAGGGCTGGGGG + Intergenic
925929841 2:8698170-8698192 CTGTTGGAGGAGGGGTCAGGTGG + Intergenic
926096759 2:10086298-10086320 ATGTTGGAGGAGAGACCTGGTGG + Intergenic
926099447 2:10104952-10104974 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
926116550 2:10217365-10217387 CCGTGGTAGGTGAGGGCTGGAGG - Intergenic
926143727 2:10384307-10384329 TTGTGGGAGGAGAGGGGTGGAGG + Intronic
926173794 2:10571143-10571165 GTGTTGGAGGAGGGGCCTGGAGG + Intronic
926616245 2:14999431-14999453 GTGTTGGAGCAGAGGCCTGGTGG + Intergenic
926758378 2:16253814-16253836 CTGTTCCAGGAGAGTGGTGAGGG + Intergenic
926786566 2:16523897-16523919 ATGTTGCTGGTGAGGGTTGGGGG + Intergenic
927106752 2:19834303-19834325 GTGTTGGAGGAGGGGACTGGTGG - Intergenic
927117389 2:19918207-19918229 CTCTTGTAGGAGAGGCCTGATGG - Intronic
927156698 2:20224978-20225000 CTGTCCCAGGCGAGGGCTGCAGG + Exonic
927182636 2:20457792-20457814 CTGAGGCAGTAGAGGGCAGGAGG - Intergenic
927395656 2:22648043-22648065 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
927509255 2:23634257-23634279 CCTTGGCAGGAGAGGGCTGTGGG + Intronic
927717293 2:25360893-25360915 CTCCTGCAGGGGAGGGCAGGTGG + Intergenic
927873783 2:26640835-26640857 CTGGTGCAGGAGACAGATGGAGG + Intronic
927884274 2:26709008-26709030 ATGTTGGAGGAGAGGGCTGTAGG + Intronic
928196500 2:29220158-29220180 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
928218304 2:29380826-29380848 GTGTTGGAGGAGGGGGCTGGTGG - Intronic
928233024 2:29516279-29516301 CTGTTTCAGGACAGGTGTGGGGG - Intronic
928235532 2:29536217-29536239 GTGTTGGAGGTGAGGCCTGGTGG + Intronic
928541116 2:32284397-32284419 GTGTTGGAGGAGAGGCCTGGTGG + Intronic
928719510 2:34103016-34103038 CTGTTGGAGGCGGGGCCTGGTGG - Intergenic
928720487 2:34115250-34115272 TTCTTGAAGGAGAGGCCTGGAGG + Intergenic
928786261 2:34889845-34889867 ATGTTGCAGAAGGGGCCTGGTGG + Intergenic
929123986 2:38506408-38506430 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
929315211 2:40469250-40469272 ATGTTGGAGGAGAGGCCTGGTGG + Intronic
929401082 2:41582455-41582477 CTGTTGCAGAATATGGGTGGGGG - Intergenic
929572115 2:43029230-43029252 CTGTTGCGGGAGAGGTGAGGTGG - Intergenic
929591020 2:43146303-43146325 CTGTGGGAGGAGGGGCCTGGAGG - Intergenic
929814068 2:45217384-45217406 GTGTTGGAGGAGGGGTCTGGTGG + Intergenic
930934315 2:56929137-56929159 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
930945394 2:57067789-57067811 CTCTTGTAGGGGAGGCCTGGTGG + Intergenic
931020385 2:58038148-58038170 GTGTTGAGGGAGAGGCCTGGTGG + Intronic
931153971 2:59607075-59607097 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
931475636 2:62585027-62585049 CTCTTGCAGGGCAGGCCTGGTGG + Intergenic
931732385 2:65164819-65164841 GAGTTGCAGAAGAGAGCTGGGGG + Intergenic
931778796 2:65562591-65562613 GTGTTGGAGGTGAGGTCTGGTGG - Intergenic
932060991 2:68497321-68497343 GTGTTGGAGGAGTGGCCTGGTGG + Intronic
932461890 2:71887599-71887621 GTGTTGGAGAAGAGGTCTGGTGG + Intergenic
932826946 2:74949666-74949688 CTCTTGCAGGGCAGGCCTGGTGG - Intergenic
933046046 2:77538811-77538833 GTGTTGGAGGAGAGACCTGGTGG + Intronic
933164772 2:79064011-79064033 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
933382465 2:81566888-81566910 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
933949645 2:87317531-87317553 ATGTTGGAGGTGAGGCCTGGTGG - Intergenic
934473200 2:94574331-94574353 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
934871353 2:97869301-97869323 CTCCTGCAGGAGAGGGCTGTGGG + Intronic
934916668 2:98305787-98305809 CTGTGGCAGGAGGAGGCTGGAGG - Intronic
935090598 2:99891558-99891580 CTGCTGCAGGTGCGGGCAGGCGG + Intronic
935349234 2:102139553-102139575 ATGTTGGAGGTGGGGGCTGGTGG + Intronic
935384649 2:102487516-102487538 CTAGAGCAGGACAGGGCTGGAGG + Intronic
935489234 2:103696758-103696780 CTCTTGCAGGGCAGGCCTGGTGG + Intergenic
935798849 2:106672016-106672038 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
935851488 2:107225536-107225558 GTGTTGAAGGAGGGGCCTGGTGG + Intergenic
936168686 2:110148137-110148159 ATGTTGAAGGTGAGGCCTGGTGG + Intronic
936171717 2:110182608-110182630 CTCTTGCAGGGCAGGCCTGGTGG - Intronic
936330548 2:111544066-111544088 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
936730216 2:115374013-115374035 GTGTTGCAAGAGAGGCCTGGTGG - Intronic
936821899 2:116531282-116531304 ATGTTGGAAGAGAGGCCTGGTGG + Intergenic
936904768 2:117524781-117524803 CTGTGGAAGTAGGGGGCTGGGGG - Intergenic
937140241 2:119593977-119593999 CTGTTGGAGGTGGGGCCTGGTGG - Intronic
937178934 2:119971345-119971367 GTGTTGGAGGAGAGGCCTTGTGG - Intronic
937208091 2:120249677-120249699 CTGTTGGAGGCGGGGCCTGGTGG - Intronic
937345216 2:121121163-121121185 CTGTGGAAGGGGAGGGCAGGGGG + Intergenic
937475826 2:122214367-122214389 CTGTTGTGGGAGGGAGCTGGTGG + Intergenic
937621477 2:123992793-123992815 CTCTTGCAGGGAAGGCCTGGTGG - Intergenic
938222558 2:129582714-129582736 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
938600031 2:132828315-132828337 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
938639832 2:133266762-133266784 CCGCGGCAGGAGAGGGCTCGGGG - Intronic
938800213 2:134755976-134755998 GTGTTGCAGGTGAGGCCTAGTGG - Intergenic
938982071 2:136536515-136536537 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
939241811 2:139571343-139571365 ATGTTGGAGGTGAGGTCTGGCGG + Intergenic
939391336 2:141572395-141572417 CTCTTGCAGGGCAGGCCTGGTGG - Intronic
939600014 2:144177121-144177143 ATGTTGCAGGTGAGGCCTGGTGG - Intronic
939744295 2:145950355-145950377 CTCTTGTAGGACAGGCCTGGTGG + Intergenic
939754495 2:146093442-146093464 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
939754745 2:146095431-146095453 CTATTGAAGGAGGGGCCTGGTGG - Intergenic
939929116 2:148209920-148209942 CTGTTGAAGGTGGGGCCTGGTGG - Intronic
940081177 2:149803044-149803066 CTTCTGCAGGAGGAGGCTGGTGG - Intergenic
940245719 2:151613651-151613673 ATGTTGGAGGAGGGGCCTGGTGG + Intronic
940977071 2:159958113-159958135 GTGTTGAAGGTGAGGCCTGGTGG + Intronic
941394809 2:164961360-164961382 GTGTTGCAGGTGGGGCCTGGTGG - Intergenic
942813735 2:180026727-180026749 ATGTTGGAGGAGGGGTCTGGGGG - Intergenic
943234833 2:185304320-185304342 CTTTTGGAGGAGAGGCCTCGTGG + Intergenic
943443802 2:187956964-187956986 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
943549504 2:189321131-189321153 CTGTTGTAGGGCAGGCCTGGTGG - Intergenic
944167750 2:196741456-196741478 CTTTTGCAAGACAGGCCTGGTGG + Intronic
944385303 2:199156776-199156798 CTCTTGCAGGGCAGGTCTGGTGG - Intergenic
944938216 2:204592127-204592149 CCTTTGTAGGAGATGGCTGGAGG + Intronic
944942352 2:204642721-204642743 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
945164521 2:206928358-206928380 CTCTTGCAAGACAGGCCTGGTGG - Intergenic
945524179 2:210867606-210867628 CTCTTGCAAGACAGGCCTGGTGG - Intergenic
945770068 2:214031931-214031953 GTGTTGGAGGAGGGGCCTGGTGG - Intronic
945866054 2:215177163-215177185 GTGTTGGAGGAGAGGCCTGGAGG + Intergenic
945919162 2:215737902-215737924 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
945941078 2:215950853-215950875 GTGTTGAAGGAGGGGCCTGGTGG + Intronic
945988115 2:216371279-216371301 CTGCAGCAGGGGTGGGCTGGGGG - Exonic
945996430 2:216440636-216440658 CTGTGGCAGGATTGGGCTGAAGG + Intronic
946205141 2:218100495-218100517 GTGTTGGAGGAGGGAGCTGGTGG - Intergenic
946333259 2:219022135-219022157 CTCTGGCAGGAGGGGGCTGGGGG - Intronic
946644242 2:221816183-221816205 GTGTTGGAGAAGAGGCCTGGTGG + Intergenic
946806741 2:223478104-223478126 GTGTTGCAGGTGGGGCCTGGTGG - Intergenic
946906956 2:224426722-224426744 GTGTTGAAGGAGGGGCCTGGTGG + Intergenic
946973534 2:225122266-225122288 CTGTTGGAGGCGGGGCCTGGTGG - Intergenic
946992163 2:225346009-225346031 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
947110977 2:226719438-226719460 ATGTTGCGGGAGAGACCTGGTGG - Intergenic
947256241 2:228167085-228167107 GTGTTGGAGGTGAGGCCTGGTGG - Intronic
947318586 2:228892342-228892364 TTGTTGGAGAAGAGGACTGGTGG + Intronic
947961960 2:234247466-234247488 CTGTTGGAGGTGAGGCCTGATGG + Intergenic
947963913 2:234262850-234262872 GTGTTGGAGGTGAGGCCTGGGGG + Intergenic
948068930 2:235104181-235104203 GTGTTGCAGGTGGGGCCTGGTGG - Intergenic
948088217 2:235267976-235267998 CTGTTGCTTCAGGGGGCTGGAGG - Intergenic
948209667 2:236183500-236183522 CTGTTGGAGGTGGGGCCTGGTGG + Intergenic
948221426 2:236272728-236272750 ATGTTGGAGGAGAGGCCTGGGGG + Intergenic
948501579 2:238398147-238398169 CTGCAGCAGGAGAGAGGTGGGGG + Intronic
948583654 2:239004802-239004824 CTGCTGCACCAGAGGACTGGGGG + Intergenic
948718989 2:239884245-239884267 CTGTGGGAGGAGACAGCTGGAGG - Intergenic
948730854 2:239962960-239962982 CTGTTGGAGGTGGGGTCTGGTGG - Intronic
948755034 2:240154711-240154733 CTGTAGGTGCAGAGGGCTGGGGG + Intergenic
1168770903 20:416004-416026 GTGTTGAAGGTGAGGCCTGGTGG - Intronic
1169377000 20:5074147-5074169 GTGTTGGAGGAGGGGCCTGGTGG - Intronic
1169643278 20:7778989-7779011 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
1169964722 20:11203693-11203715 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1170182067 20:13543116-13543138 GTGTTGGAGGACAAGGCTGGAGG - Intronic
1170226979 20:14001784-14001806 CAGTAGCACGAGAGGGTTGGGGG + Intronic
1170446010 20:16428560-16428582 CTTTTGAAGGAGAGGGTTGTAGG - Intronic
1170798436 20:19570305-19570327 GTGTTGGAGGAGGGGCCTGGTGG - Intronic
1170834491 20:19872028-19872050 GTGTTGAAGGAGGGAGCTGGTGG + Intergenic
1171403724 20:24895679-24895701 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1171490529 20:25513637-25513659 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
1171505305 20:25628255-25628277 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
1171884596 20:30642742-30642764 ATGTTGCAGGTGGGGCCTGGTGG - Intergenic
1172477643 20:35250866-35250888 CTGTTGGAGGCGGGGCCTGGTGG - Intronic
1173776926 20:45716298-45716320 CTCTTGCAAGACAGGCCTGGTGG - Intergenic
1173951519 20:46997316-46997338 GTGTTGGAGGAGGGGCCTGGTGG - Intronic
1174089429 20:48035217-48035239 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
1174138774 20:48398499-48398521 CTGTACCTGGAGGGGGCTGGGGG + Intergenic
1174539833 20:51280293-51280315 TTGTTGGAGGAGAGGCCTCGTGG - Intergenic
1174751885 20:53119094-53119116 GTGTTGGAGGTGAGGCCTGGTGG - Intronic
1175257340 20:57655335-57655357 GTGGTGCAGGAGGGGACTGGAGG - Intronic
1175274939 20:57761990-57762012 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1175652438 20:60737227-60737249 GTGTTGGAGGGGAGGCCTGGTGG + Intergenic
1175666890 20:60868836-60868858 CTGCTGCAGGAGGGGCGTGGTGG - Intergenic
1176073741 20:63239263-63239285 CTGGGGCAGGGGAGGGCTGAGGG + Intronic
1176249361 20:64112921-64112943 GAGATGTAGGAGAGGGCTGGAGG + Intergenic
1176270016 20:64231452-64231474 GTGTTCCAGGAGAGGGATAGAGG - Intronic
1176844288 21:13864738-13864760 CTGTTGCAGGTGGGGCCTGGTGG - Intergenic
1176844743 21:13868144-13868166 ATGTTGCAGGTGAGGCCTGGTGG - Intergenic
1176869704 21:14075040-14075062 CTGTTGTAGCAGAGGGCATGGGG + Intergenic
1176885269 21:14247921-14247943 CTGTTGGAGGTGGGGCCTGGCGG - Intergenic
1177106222 21:16958722-16958744 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1177160870 21:17546616-17546638 GTGTTGGAAGAGAGGCCTGGTGG - Intronic
1177396983 21:20549216-20549238 GTGTTGGAGGAGAAGCCTGGTGG + Intergenic
1177463685 21:21446008-21446030 CTTTTGCAGGGCAGGCCTGGTGG + Intronic
1177523315 21:22259540-22259562 GTGTTGCAGGAGGGACCTGGTGG + Intergenic
1177556468 21:22695620-22695642 CTCTTGCAAGACAGGCCTGGTGG + Intergenic
1177578480 21:22989010-22989032 CTGTTGTGGGAGAGACCTGGTGG + Intergenic
1177602534 21:23334917-23334939 GTGTTGGAAGAGAGGCCTGGTGG + Intergenic
1177869714 21:26556758-26556780 GTGTTGTAGGAGGGGCCTGGTGG - Intronic
1177878729 21:26667743-26667765 CTCTTGCAGGGCAGGCCTGGTGG + Intergenic
1178052499 21:28763512-28763534 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
1178154086 21:29831695-29831717 GTGTTGGAGGAGGGGTCTGGTGG - Intronic
1178292919 21:31384997-31385019 CTGTTGGAGGTGGGGGCTAGTGG + Intronic
1178310279 21:31524427-31524449 GTGTTGGAGGAGGGGCCTGGTGG - Intronic
1178345004 21:31818404-31818426 CTCTTGTAGGGCAGGGCTGGTGG + Intergenic
1179096546 21:38321146-38321168 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
1179101770 21:38360652-38360674 ATGTTGTGGGAGAGGGCAGGTGG + Intergenic
1179167196 21:38944346-38944368 CTGTTGGAGGAGCAGGCGGGAGG - Intergenic
1179603793 21:42499093-42499115 CTGCTGCAGGAGATGCCGGGAGG - Intronic
1179724681 21:43335511-43335533 CTGGGGTAGGAGAGGGCAGGAGG + Intergenic
1180204887 21:46253457-46253479 ATGTTGGAGGAGGGGCCTGGTGG + Intronic
1180840002 22:18954796-18954818 GGGTGGCAGGAGAGGCCTGGAGG - Intergenic
1180942587 22:19669076-19669098 GTGTTGGAGGTGAGGTCTGGTGG - Intergenic
1181061898 22:20285684-20285706 GGGTGGCAGGAGAGGCCTGGAGG + Intergenic
1181836764 22:25616516-25616538 ATGTTGAAGGAGGGGCCTGGTGG - Intronic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182197643 22:28535639-28535661 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
1183214145 22:36468223-36468245 CAGCTGCAGGCCAGGGCTGGGGG + Intronic
1183293294 22:37015842-37015864 CTCTTGGAGGAGGGGGTTGGGGG + Intronic
1183306599 22:37086242-37086264 CTGGGGCAGGGGAGGGGTGGTGG - Intronic
1183727706 22:39598592-39598614 CGGGTGCAGGAGAAGGCTGGTGG - Intronic
1183744260 22:39684329-39684351 CATGGGCAGGAGAGGGCTGGAGG - Exonic
1184560088 22:45257638-45257660 ATGTTGGAGGCGAGGACTGGTGG + Intergenic
1184610987 22:45602964-45602986 CTGGAGCAGAAGAGGGCAGGAGG + Intergenic
1184860214 22:47169248-47169270 CTGTTGAAGTTGAGGGCCGGTGG - Intronic
1184880593 22:47302027-47302049 CCATGGCAGGAGAGGCCTGGAGG + Intergenic
1185120236 22:48961951-48961973 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1185197145 22:49478815-49478837 GTGTTGGACGAGAGGCCTGGTGG - Intronic
1185209458 22:49561508-49561530 ATAGTGCAGGAGAGGGCAGGAGG + Intronic
1185325245 22:50222347-50222369 CTCTTCTAGGAGAGGGCTGGTGG - Intronic
949149064 3:742435-742457 GTGTTGGAGGGGAGGGATGGTGG + Intergenic
949387304 3:3517408-3517430 CTGTTGGAGGTGGGGCCTGGTGG + Intergenic
949749970 3:7340528-7340550 GTGTTGAAGGAGAGACCTGGTGG - Intronic
949951937 3:9236435-9236457 GTGTTGGAGGTGGGGGCTGGTGG + Intronic
950239283 3:11353550-11353572 CTGTTGGAGGTGGGGCCTGGTGG + Intronic
950523772 3:13511523-13511545 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
950975469 3:17238221-17238243 CTGTTGCAAGTGATGGCTTGGGG + Exonic
951182326 3:19673001-19673023 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
951242667 3:20305244-20305266 CTGTTGTAGGAGAGACCTGGTGG - Intergenic
951921063 3:27854416-27854438 CTCTTGCAAGGGAGGCCTGGTGG - Intergenic
952190171 3:31014698-31014720 CTGGAGCAGGAGAGGCCTTGTGG + Intergenic
952644099 3:35635582-35635604 CTGATGCAGAACAGGGCTGGAGG - Intergenic
952697127 3:36279112-36279134 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
952784833 3:37142923-37142945 GTGTTGGAGGTGAGGCCTGGTGG + Intronic
952808218 3:37377587-37377609 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
952841976 3:37654259-37654281 CTGTGGCAGGAGAGGGCTGAAGG + Intronic
953027598 3:39153802-39153824 CGCTGGCGGGAGAGGGCTGGGGG - Intronic
953160838 3:40417536-40417558 GTGTTGGAGGAGGGGCCTGGTGG - Intronic
953360655 3:42293316-42293338 ATGTTGTAGGAGAGACCTGGTGG + Intergenic
953471077 3:43167186-43167208 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
953696767 3:45165926-45165948 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
953786798 3:45917201-45917223 TGGCAGCAGGAGAGGGCTGGCGG + Intergenic
954138064 3:48591374-48591396 GTGTGGAAGGAGAGGGCTGGAGG + Intronic
954455406 3:50595836-50595858 TGTTTGCAGGAGAGGTCTGGAGG - Intergenic
954627826 3:52032276-52032298 CTGTTGCAGATACGGGCTGGGGG - Intergenic
954674176 3:52306618-52306640 CTGGGGCTGGATAGGGCTGGAGG + Intergenic
954709683 3:52499287-52499309 TTGTTGCCGTAGAAGGCTGGTGG + Intronic
955092667 3:55767922-55767944 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
955479654 3:59376678-59376700 GTGTTGGAGGAAAGGGCTGATGG + Intergenic
955638697 3:61058471-61058493 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
955765895 3:62343573-62343595 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
956004462 3:64763584-64763606 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
956172809 3:66445993-66446015 CTGCTGCAGCTCAGGGCTGGGGG - Intronic
956323698 3:68027128-68027150 GTGTTGCAGGTGGGGCCTGGTGG - Intronic
956489321 3:69754074-69754096 ATGTTGCAGGTGAGGCCTGATGG + Intronic
956886392 3:73564440-73564462 CAGGTGCTGGAGAGGGCTGATGG - Intronic
957329477 3:78743242-78743264 CCGTTTCAGGGGAGGGGTGGGGG - Intronic
957505546 3:81115978-81116000 CTGTTGAAGGAGGGGCCTGGTGG - Intergenic
957506696 3:81130771-81130793 GTGTTGAAGGAGAGGCTTGGTGG + Intergenic
957553064 3:81731592-81731614 ATGTTGGAGGAGGGGCCTGGTGG + Intronic
957678908 3:83405995-83406017 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
957876223 3:86149881-86149903 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
958073052 3:88639568-88639590 CTCTTGCAGGACAGGCCTGGTGG + Intergenic
958540199 3:95461327-95461349 TTGTTGCAGGTGGGGCCTGGTGG - Intergenic
958543307 3:95508871-95508893 GTGTTGGAGGAGTGGCCTGGTGG + Intergenic
958550141 3:95601743-95601765 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
958567797 3:95836833-95836855 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
958740113 3:98058827-98058849 GTGTTGCAGGAGAGGCCTGGTGG - Intergenic
958825716 3:99027988-99028010 TTGTTGTAGGACAGGTCTGGTGG - Intergenic
958987490 3:100799260-100799282 CTGTTGCAGGAAATGAGTGGAGG - Intronic
958993186 3:100871481-100871503 ATGTTGCGGGAGGGGCCTGGTGG + Intronic
959043839 3:101449684-101449706 CTGTTGTAGGGCAGGCCTGGTGG - Intronic
959188431 3:103077795-103077817 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
959278405 3:104306263-104306285 CTTTTGCAGGGCAGGCCTGGTGG - Intergenic
959423014 3:106150984-106151006 CTCTTGCAGGGCAGGCCTGGTGG + Intergenic
959452910 3:106524840-106524862 CTCTTGCAGGGTAGGCCTGGTGG - Intergenic
959655548 3:108800424-108800446 CTGTTGGAGGTGGGGTCTGGTGG + Intergenic
959880655 3:111441285-111441307 CTGTTGCAGGGGGAGGCTAGGGG - Intronic
959883327 3:111472042-111472064 CTGTTGCAAGGCAGGCCTGGTGG + Intronic
960150758 3:114246463-114246485 ATGTTGGAGGAGGGGTCTGGGGG + Intergenic
960477061 3:118143456-118143478 CTCTTGCAGGGCAGGCCTGGTGG + Intergenic
960574840 3:119219214-119219236 CTTTTGCAGGGGAGGGTTGAAGG + Intronic
960673981 3:120177230-120177252 CTGAGGGAGCAGAGGGCTGGGGG + Intronic
960841043 3:121959038-121959060 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
961017895 3:123481703-123481725 CTGTGACAGGGAAGGGCTGGTGG - Intergenic
961677689 3:128577684-128577706 CTGTTGGGGCAGAGGGCAGGTGG - Intergenic
961747668 3:129075664-129075686 ATGTTGAAGGTGAGGCCTGGTGG - Intergenic
962125051 3:132608089-132608111 CTGTTGTAAGACAGGCCTGGTGG - Intronic
962218990 3:133547470-133547492 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
962314376 3:134350195-134350217 CTCTAGCAGGAGTGGGGTGGGGG - Intergenic
962328129 3:134452939-134452961 GTGTTGGAGGAGAGACCTGGTGG - Intergenic
962456811 3:135572486-135572508 GTGTTGAAGGAGGGGCCTGGTGG - Intergenic
962761558 3:138519647-138519669 CTCTTGTAGGACAGGCCTGGTGG - Intronic
962871034 3:139493364-139493386 ATGTTGGAGGAGGGGTCTGGTGG + Intergenic
963009001 3:140752031-140752053 CTGTTGCAGGAGTGAAATGGGGG + Intergenic
963126532 3:141821790-141821812 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
963227144 3:142873973-142873995 ATGTTGCAGGAGGAGCCTGGTGG + Intronic
963532202 3:146484755-146484777 CTCTTGCAGGGCAGGACTGGTGG - Intronic
963572683 3:147016904-147016926 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
963983754 3:151568684-151568706 CTATTGCATGGGAGGGTTGGAGG - Intergenic
964173051 3:153793623-153793645 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
964334422 3:155639792-155639814 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
964507155 3:157411936-157411958 ATGTTGGAGGTGAGGCCTGGTGG + Intronic
964884071 3:161460089-161460111 ATGTTGGAGGAGGGGTCTGGTGG + Intergenic
964995963 3:162881637-162881659 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
965263530 3:166512448-166512470 CTCTTGCAGGGCAGGCCTGGTGG - Intergenic
965389195 3:168084045-168084067 ATGTTGCAGGAGAGGCCTGGTGG + Intronic
965446089 3:168776363-168776385 ATGTTGTAGGAGGGAGCTGGTGG + Intergenic
965619186 3:170625422-170625444 ATGTTGGAGGAGGGGCCTGGTGG + Intronic
965855892 3:173087699-173087721 CTCTTGCAAGGGAGGCCTGGTGG + Intronic
966304231 3:178512976-178512998 GTGTTGGAGGTGAGGCCTGGTGG + Intronic
966452460 3:180077818-180077840 GTGTTGAAGGAGGGGGCTGGTGG - Intergenic
966452717 3:180079780-180079802 ATGTTGAAGGAGGGGCCTGGTGG - Intergenic
966513766 3:180794190-180794212 GTGTTGGAGGAGAGGCCTGGTGG + Intronic
967675927 3:192299039-192299061 CTGTTGGAGGCGGGGCCTGGTGG - Intronic
968265880 3:197363043-197363065 CTAATGCAGTAGAGTGCTGGCGG - Intergenic
968265887 3:197363081-197363103 CTGTTGCAGGAGAGGCCTTATGG + Intergenic
968497066 4:924651-924673 ATGTTGGAGGAGGGGCCTGGTGG + Intronic
968529979 4:1086592-1086614 GGGTGGCAGGAGAGGGGTGGGGG + Intronic
968697179 4:2036992-2037014 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
968950491 4:3688867-3688889 CTGTGGGATGTGAGGGCTGGTGG - Intergenic
969075175 4:4572501-4572523 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
969111069 4:4844605-4844627 TTGTGGCAGGGGAGGGTTGGGGG - Intergenic
969132297 4:5000539-5000561 CTCTTGCAAGGCAGGGCTGGTGG + Intergenic
969202242 4:5615539-5615561 CTGTTGCTGGAGAGGGGTTGGGG + Exonic
969276118 4:6137021-6137043 CTGGTGCAGAGGAGGACTGGAGG - Intronic
969295642 4:6269538-6269560 CTGTTACAGGAGAAGGCGAGCGG + Intergenic
969333170 4:6491633-6491655 ATGTTGGAGGAGGGGCCTGGTGG + Intronic
969441987 4:7222711-7222733 CTGTGGCAGGAGAGAGCGGGAGG + Intronic
969494859 4:7520720-7520742 CTGTGGGCGGAGAGGGCTGGCGG - Intronic
969747267 4:9082493-9082515 CTCTTGCAGGGCAGGCCTGGTGG - Intergenic
970046145 4:11856873-11856895 CTGCTGCAGTGGAGGGCAGGAGG - Intergenic
970224996 4:13848766-13848788 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
970246945 4:14073506-14073528 ATGTTGAAGGAGGGGCCTGGTGG + Intergenic
970432576 4:16002181-16002203 CTGTTGCAGGAAAGTGTGGGGGG + Intronic
970494505 4:16611180-16611202 CTCTTGCAGGGCAGGCCTGGTGG - Intronic
970643420 4:18092184-18092206 CTCTTGTAGGACAGGCCTGGTGG - Intergenic
970683664 4:18540399-18540421 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
970689039 4:18601302-18601324 CTGTTGTAGGGCAGGCCTGGTGG + Intergenic
970756969 4:19438139-19438161 GTGTTGAAGGAGAGACCTGGTGG + Intergenic
971035517 4:22688874-22688896 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
971072059 4:23105390-23105412 CTGTTGTGGGAGAGACCTGGTGG + Intergenic
971157706 4:24101105-24101127 CTGTTGGAGGTGGGGCCTGGTGG + Intergenic
971216917 4:24670670-24670692 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
971466408 4:26967816-26967838 CTGTTGGAGGAGGGGGGAGGGGG - Intronic
971473817 4:27053903-27053925 CAGTTACAGGGAAGGGCTGGTGG + Intergenic
971550756 4:27953067-27953089 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
971650382 4:29263766-29263788 CTGGTGCTGGAGAGGGATGAGGG + Intergenic
971701099 4:29977674-29977696 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
971896566 4:32604753-32604775 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
972135272 4:35885357-35885379 GTGTTGCAGGTGGGGACTGGTGG + Intergenic
972145648 4:36021369-36021391 CTGTTGGAGGTGGGGCCTGGTGG + Intronic
972296675 4:37745838-37745860 ATGTTGAAGGTGAGGCCTGGTGG - Intergenic
972296931 4:37748065-37748087 GTGTTGAAGGAGGGGCCTGGTGG - Intergenic
972317697 4:37943012-37943034 CTCTTGCAGGACAGGCCTGGTGG + Intronic
972661757 4:41123079-41123101 CTGGGGCAAGAGAGGGCTGCTGG - Intronic
972688504 4:41373810-41373832 ATGTTGGAGGAGGGGCCTGGTGG + Intronic
972774403 4:42227986-42228008 GTGTTGGAGGAGAGGACTGGTGG + Intergenic
972828783 4:42790082-42790104 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
973012648 4:45095210-45095232 ATGTTGGAGGTGAGGCCTGGTGG - Intergenic
973074487 4:45905299-45905321 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
973131418 4:46653234-46653256 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
973180121 4:47256800-47256822 GTGTTGGAGGAGGGGTCTGGTGG - Intronic
973392799 4:49570397-49570419 ATGTTGCAGGTGGGGCCTGGTGG + Intergenic
973543624 4:51958735-51958757 TTGTTGCAGGGGGGTGCTGGGGG + Intergenic
973849356 4:54945924-54945946 CTGAAGCAGGAGAGGGCGAGAGG - Intergenic
974009083 4:56591107-56591129 GTGTTGGAGGAGGGGTCTGGTGG + Intronic
974161955 4:58151488-58151510 CTGTTGTAGGGCAGGCCTGGTGG - Intergenic
974171479 4:58271543-58271565 GTGTTGTAGGAGAGACCTGGTGG + Intergenic
974347245 4:60697786-60697808 CTCTTGTAGGACAGGCCTGGTGG - Intergenic
974573379 4:63685160-63685182 GTGTTGTAGGAGAGACCTGGTGG + Intergenic
974608349 4:64183146-64183168 GTGTTGAAGGAGGGGCCTGGTGG - Intergenic
974624195 4:64400574-64400596 GTGTTGCAGGTGGGGCCTGGTGG + Intronic
974629134 4:64460572-64460594 CTGTAGGAGGGGAGGGGTGGGGG - Intergenic
974868999 4:67615131-67615153 GTGTTGGAGGTGAGGGCTGGTGG + Exonic
975035530 4:69675364-69675386 GTGTTGCAGGAGGGGCCTGTTGG - Intergenic
975483264 4:74905513-74905535 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
975505581 4:75133269-75133291 CTGTTGCAGGTGAGGGGCGATGG - Intergenic
975517924 4:75267478-75267500 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
975776708 4:77795452-77795474 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
975916991 4:79337078-79337100 CTTTTGCTGGAGTGGGCTGTTGG + Intergenic
975981089 4:80160190-80160212 CTGTTGGAGGTCAGGACTGGTGG - Intergenic
976195915 4:82531008-82531030 GTGTTGGAGGTGAGGCCTGGTGG - Intronic
976537991 4:86241012-86241034 CTCTTGCAGGGCAGGCCTGGTGG + Intronic
976649428 4:87419120-87419142 GTGTTGGAGGTGAGGTCTGGTGG - Intergenic
976883225 4:89955646-89955668 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
976985536 4:91291712-91291734 CTGTTGGAGGTGGGGCCTGGTGG - Intronic
977202369 4:94132256-94132278 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
977303793 4:95298488-95298510 CTGAGGCAGGAGTGTGCTGGTGG - Intronic
977325144 4:95565321-95565343 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
977349747 4:95867454-95867476 CTGTTGGAGGTGGGGCCTGGTGG + Intergenic
977478159 4:97539007-97539029 CTCTTGTAGGACAGGCCTGGTGG - Intronic
977497734 4:97799359-97799381 CTCTTGTAGGACAGGCCTGGTGG + Intronic
977612704 4:99052639-99052661 GTGTTGGAGGAGAGGCCTGGTGG - Intronic
977984073 4:103361093-103361115 GTGTTGGAGGAGGGGGCTGGTGG + Intergenic
978251581 4:106637406-106637428 GTGTTGGAGGAGAGACCTGGTGG + Intergenic
978328099 4:107581156-107581178 CTCTTGCAAGGCAGGGCTGGTGG - Intergenic
978396087 4:108281573-108281595 GTGTTGGAGGAGGGGTCTGGTGG - Intergenic
978417139 4:108488506-108488528 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
978602513 4:110443600-110443622 TTATTGAAGGAGAGGTCTGGTGG + Intronic
978675815 4:111314616-111314638 TTGTTGGAGGAGTGGCCTGGTGG + Intergenic
978710186 4:111770681-111770703 CTGTGGCAGCACAGGGCTGGGGG + Intergenic
979049210 4:115909220-115909242 CTGTTCGAGGTGAGGCCTGGTGG - Intergenic
979122259 4:116918939-116918961 GTGTTGAAGGAGGGGCCTGGTGG + Intergenic
979125812 4:116970114-116970136 ATGTTGAAGGAGGGGCCTGGTGG + Intergenic
979197639 4:117939949-117939971 CTCTTGCAGGGCAGGCCTGGTGG + Intergenic
979225051 4:118275353-118275375 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
979233905 4:118377382-118377404 GTGTTGCAGGAGGGACCTGGTGG - Intergenic
979515391 4:121603251-121603273 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
979611653 4:122695614-122695636 ATGTTGGAGGAGAGGCCTGGTGG + Intergenic
979921289 4:126499714-126499736 CTCTTGTAGGACAGGCCTGGTGG - Intergenic
980090686 4:128440386-128440408 GTGTTGAAGGAGGGGCCTGGTGG - Intergenic
980153581 4:129079084-129079106 GTGTTGGAGGAGAGCCCTGGTGG - Intronic
980261715 4:130457909-130457931 CTGTTGTGGGTGGGGGCTGGGGG + Intergenic
980406920 4:132365821-132365843 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
980439509 4:132821582-132821604 GTGTTGAAGGAGGGGCCTGGTGG - Intergenic
980482418 4:133404165-133404187 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
980484703 4:133440581-133440603 GTGTTGCAGGGGTGGGCTGTGGG - Intergenic
980740853 4:136947941-136947963 TTCTTGCAGGACAGGTCTGGTGG + Intergenic
980798734 4:137719843-137719865 GTGTTGAAGGAGGGGCCTGGTGG + Intergenic
980888877 4:138793101-138793123 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
981193037 4:141885812-141885834 GTGTTGAAGGAGGGGCCTGGTGG + Intergenic
981321377 4:143395962-143395984 CTGTTGAAGGAGAGGGCATATGG + Intronic
981391664 4:144197700-144197722 TTGTTGGAGGAGGGGTCTGGTGG + Intergenic
981560769 4:146046440-146046462 CTCTTGCAGGGCAGGCCTGGTGG + Intergenic
981750852 4:148091319-148091341 CTGTAGCAGGCCAGGGTTGGGGG - Intronic
981805136 4:148706766-148706788 GTGTTGAAGGAGGGGCCTGGTGG + Intergenic
982272888 4:153609399-153609421 ATGTTGGAGGAGGGGCCTGGTGG - Intronic
982490229 4:156020841-156020863 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
982566763 4:156996189-156996211 ATGTTGGAGGAGAGGCCTGGTGG - Intergenic
982626977 4:157779879-157779901 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
982823476 4:159973577-159973599 ATGTTGCAGGTGGGGTCTGGGGG - Intergenic
983239964 4:165221267-165221289 GTGTTGCAGAGGAGGGCTGCTGG + Intronic
983315857 4:166132702-166132724 CTTTTGCAAGACAGGACTGGTGG + Intergenic
983469196 4:168136149-168136171 GTGTTGGAGGAGGGGCCTGGTGG - Intronic
983670471 4:170231478-170231500 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
983876581 4:172883619-172883641 GTGTTGGAGGTGAGGCCTGGTGG - Intronic
983886643 4:172987637-172987659 GTGTTGGAGAAGAGGTCTGGTGG + Intronic
983927622 4:173418698-173418720 GTGTTGCAGGAGGGGCCAGGTGG + Intergenic
984017741 4:174445886-174445908 CTGTTGGAGGAGGGGCCTGGTGG + Intergenic
984042832 4:174757866-174757888 GTGTTGCAGGTGGGGCCTGGTGG + Intronic
984215954 4:176912620-176912642 CTCTTGCAGGGGAGGCCTGGTGG - Intergenic
984335215 4:178380942-178380964 CTCTTGCAGGGCAGGCCTGGTGG - Intergenic
984380820 4:178990164-178990186 CTCTTGTAGGACAGGCCTGGTGG - Intergenic
984401393 4:179269857-179269879 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
984511461 4:180683967-180683989 CTGTTGCAAGGGAGGCCTTGAGG + Intergenic
984882407 4:184421914-184421936 GTGTTGCAGGTGGGGTCTGGTGG + Intronic
985060477 4:186072731-186072753 GTGTTGGAGGTGGGGGCTGGTGG - Intronic
985096163 4:186415112-186415134 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
985702084 5:1379553-1379575 CTGCTGCAGGAGAGGTATGTGGG - Intergenic
986150782 5:5128882-5128904 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
986259614 5:6132827-6132849 CTGTTGAAGGAGGGGCCTGGTGG + Intergenic
986304882 5:6507609-6507631 GTGTTGAAGGAGGGGCCTGGTGG + Intergenic
986424337 5:7615183-7615205 GTGTTGAAGGAGGGGGCTGGTGG - Intronic
986425447 5:7626807-7626829 GTGTTGGAGGTGAGGCCTGGTGG - Intronic
986474526 5:8114002-8114024 GTGTTGCAGGAGGGACCTGGTGG + Intergenic
986480764 5:8184685-8184707 CACTTGGATGAGAGGGCTGGTGG - Intergenic
986506289 5:8455615-8455637 GTGTTGGAGGCGGGGGCTGGTGG + Intergenic
986606048 5:9524010-9524032 ATGTTGAAGGAGAGGCCTGGTGG + Intronic
986692025 5:10321008-10321030 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
986694429 5:10339364-10339386 CTGTTGGAGGTGGGGGCTGGGGG + Intergenic
986836991 5:11650098-11650120 ATGTTGGAGGAGGGGCCTGGTGG + Intronic
986950064 5:13072114-13072136 GTGTTGAAGGAGAGGCCTGGTGG - Intergenic
987014247 5:13801140-13801162 ATGTTGGAGGTGAGGCCTGGTGG + Intronic
987342301 5:16949845-16949867 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
987490020 5:18568149-18568171 GTGTTGCAGGTGGGGCCTGGTGG - Intergenic
987669000 5:20984037-20984059 CTCTTGCAGGGGTGGGGTGGAGG + Intergenic
987777455 5:22386282-22386304 CTGTTAGAGGAGAGGCCTAGTGG - Intronic
988103309 5:26709820-26709842 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
988110675 5:26814672-26814694 CTCTTGCAAGACAGGCCTGGCGG - Intergenic
988139194 5:27213670-27213692 GTGTAGGAGGAGAGGCCTGGTGG - Intergenic
988320152 5:29684741-29684763 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
988433911 5:31150862-31150884 CTGCTGCAGGAGAGAGGTGTGGG + Intergenic
988440261 5:31225706-31225728 CTGTTGGAGGATAGGCCTGATGG - Intronic
988594726 5:32581241-32581263 ATGTTGGAGGAGGGGGCTGGTGG - Intronic
988884263 5:35538283-35538305 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
988945020 5:36188406-36188428 CTCTTGCAGGGCAGGCCTGGTGG + Intergenic
989284751 5:39686696-39686718 CTCTTGTAGGGGAGGCCTGGTGG + Intergenic
989415452 5:41169801-41169823 ATGTTGGAGGAGGGGTCTGGTGG - Intronic
989503454 5:42197142-42197164 GTGTTGAAGGTGAGGCCTGGTGG + Intergenic
989516453 5:42348948-42348970 ATGTTGCAAGAGAGACCTGGTGG + Intergenic
989519383 5:42383047-42383069 CTTTTGCAGGCCAGGCCTGGTGG - Intergenic
990038435 5:51350623-51350645 CTCTTGTAGGGCAGGGCTGGTGG - Intergenic
990138872 5:52680849-52680871 CTCTTGCAGGGCAGGCCTGGTGG + Intergenic
990163945 5:52974786-52974808 CTGTTGTAGGGCAGGCCTGGCGG + Intergenic
990340244 5:54814913-54814935 CTCTTGTAGGACAGGTCTGGTGG - Intergenic
990608878 5:57437798-57437820 ATGTTGCTGGTGGGGGCTGGGGG + Intergenic
990940527 5:61198995-61199017 CTCTTGCAGGGCAGGCCTGGTGG + Intergenic
991186679 5:63816346-63816368 GTGTTGAAGGAGGGGCCTGGTGG + Intergenic
991326349 5:65437493-65437515 CTGTTGTGGGAGGGGCCTGGTGG - Intronic
992149623 5:73890254-73890276 GTGTTGCAGGGGAGGGGAGGTGG - Intronic
992357274 5:75999180-75999202 GTGTTGCAGGAGGGACCTGGTGG - Intergenic
992659346 5:78943454-78943476 CTCTTGCAGGGCAGGACTGGTGG + Intronic
993084481 5:83347592-83347614 ATGTTGGAGGAGTGGCCTGGTGG - Intronic
993100987 5:83539387-83539409 CTGTTGCAGGAGAGTTTTGAGGG - Exonic
993215550 5:85018373-85018395 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
993294729 5:86121749-86121771 ATGTTGCGGGAGAGAACTGGTGG + Intergenic
993313546 5:86369539-86369561 ATGTTGAGGGAGAGGTCTGGAGG - Intergenic
993413073 5:87595825-87595847 CTGTTGTGGGAGAGGCCTGGTGG - Intergenic
993420786 5:87699051-87699073 CTCTTGCAAGATAGGGCTGATGG + Intergenic
993468466 5:88277085-88277107 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
993672921 5:90784016-90784038 CTGGTGCTGGAGCGGACTGGAGG + Exonic
993709831 5:91213796-91213818 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
993747149 5:91614473-91614495 GTGTTGGAGGAAAGGCCTGGTGG - Intergenic
994019412 5:95005500-95005522 GTGTTGAAGGAGGGAGCTGGTGG + Intronic
994048701 5:95338148-95338170 CTCCTGCAGGACAGGCCTGGTGG - Intergenic
994166002 5:96608946-96608968 GTGTTGGAGGAGAGGCTTGGTGG - Intronic
994473783 5:100241402-100241424 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
994588421 5:101741865-101741887 CTGTTGGGGGAGTGGCCTGGTGG - Intergenic
994680387 5:102879439-102879461 ATGTTGGAGGAGGGGCCTGGTGG + Intronic
994734257 5:103533092-103533114 ATGTTGAAGGAGAGACCTGGTGG + Intergenic
995003215 5:107159745-107159767 CTCTTGCAGGGCAGGCCTGGTGG - Intergenic
995258116 5:110071072-110071094 CTCTTGCAGGACAGAACTGGTGG + Intergenic
995460926 5:112402090-112402112 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
995856338 5:116596938-116596960 CTGTTGGAGGTGGGGCCTGGCGG + Intergenic
996035642 5:118755802-118755824 GTGTTGGAGGAGGGGGCTGTTGG + Intergenic
996046002 5:118873948-118873970 CAGTTGCAACAGAGTGCTGGTGG - Intronic
996194698 5:120589768-120589790 GTGTTGCAGGAGGGACCTGGTGG - Intronic
996245915 5:121263630-121263652 CAGTTGGAGGAGAGTGCGGGTGG + Intergenic
996622228 5:125520869-125520891 ATGTTGTAGGAGAGACCTGGTGG - Intergenic
996916160 5:128714507-128714529 CTGTTGCAGGACAGGCTTGGGGG - Intronic
997075272 5:130667254-130667276 CTTTTGCAGGATGGAGCTGGAGG + Intergenic
997273612 5:132563785-132563807 TTGTTGGAGGAGGGGCCTGGTGG + Intronic
998261582 5:140635760-140635782 TTGTTGGGGGAGAGGGGTGGAGG + Intergenic
998767078 5:145500172-145500194 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
999052153 5:148534461-148534483 CTCTGGCAGGGGATGGCTGGAGG - Intronic
999175583 5:149629554-149629576 CAGTGACAGGAGAGGGCAGGAGG + Intronic
999397000 5:151235829-151235851 CTGCTGGAGGAGGGGTCTGGAGG + Intronic
999679847 5:154046704-154046726 CTGTCACAGGCGAGGGCTGCAGG - Intronic
1000034605 5:157435296-157435318 GTGTTGGAGGAGGGGCCTGGTGG - Intronic
1000548728 5:162633375-162633397 GTGTTGAAGGAGGGGCCTGGTGG - Intergenic
1000686953 5:164262197-164262219 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
1000687452 5:164270030-164270052 TTGTTGGAGGTGAGGCCTGGTGG + Intergenic
1000900469 5:166905947-166905969 CTGTAGCAGGAAAGGGTTGAAGG - Intergenic
1001288699 5:170441402-170441424 CTGGTGCTGGGGAGGGGTGGGGG + Intronic
1001462252 5:171926432-171926454 TTGTTGAAGGTGAGGCCTGGTGG + Intronic
1001518221 5:172372194-172372216 ATGTTGGAGGTGGGGGCTGGTGG + Intronic
1001646443 5:173285288-173285310 GTGTTGCAGGAGGGACCTGGTGG + Intergenic
1001839510 5:174863161-174863183 CTCTTGCAGGGCAGGCCTGGTGG + Intergenic
1002967418 6:1980011-1980033 CTCTTGCAAGACAGGTCTGGTGG - Intronic
1003147616 6:3521922-3521944 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1003214970 6:4100739-4100761 ATGTTGGAGGAGGGGCCTGGTGG + Intronic
1003333649 6:5150698-5150720 CGCTTGCAGGGGAGAGCTGGAGG - Intronic
1003686892 6:8313507-8313529 CTCTTGCAGGGCAGGCCTGGTGG + Intergenic
1003782587 6:9445682-9445704 CTGTTGTAGGGCAGGCCTGGTGG - Intergenic
1003977820 6:11360466-11360488 ATGTTGCAGGTGGGGCCTGGTGG + Intronic
1003989211 6:11469258-11469280 GTGTTGCAGGTGGGGCCTGGTGG + Intergenic
1004201121 6:13549054-13549076 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1004201138 6:13549102-13549124 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
1004301281 6:14460290-14460312 ATGTTGGAGGAGGGGTCTGGTGG + Intergenic
1004353442 6:14911248-14911270 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1004373164 6:15070157-15070179 ATGTTGGAGGAGAGGCCTGGTGG + Intergenic
1004476469 6:15977923-15977945 ATGTTGCAGGAGGGGCCCGGTGG + Intergenic
1004806621 6:19210304-19210326 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1004846348 6:19647393-19647415 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1004983874 6:21058689-21058711 CTGTTGCAAGGCAGGCCTGGTGG + Intronic
1005003008 6:21261630-21261652 GTGTTGAAGGAGGGGTCTGGTGG + Intergenic
1005012253 6:21347305-21347327 CTGTTCCAGGCAAGGGCAGGGGG - Intergenic
1005184527 6:23150108-23150130 ATGTTGTGGGAGAGGCCTGGTGG - Intergenic
1005298605 6:24449760-24449782 CTGCTGCTGGATAGGGTTGGAGG - Intronic
1005984341 6:30861546-30861568 GTGTTGCAGGAGGGACCTGGTGG - Intergenic
1005984585 6:30863188-30863210 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
1006121680 6:31810744-31810766 CTGGGGCTGGAGACGGCTGGGGG - Exonic
1006282604 6:33067248-33067270 GTGTTGCAGGTGGGGCCTGGTGG + Intronic
1006421722 6:33938737-33938759 GTATTGGAGGAGAGGCCTGGTGG - Intergenic
1006712378 6:36085135-36085157 CTCTTGCAAGACAGGCCTGGTGG - Intronic
1007224418 6:40302863-40302885 CTGTGTGAGGGGAGGGCTGGTGG + Intergenic
1007730616 6:43943293-43943315 GTGTGGAAGGTGAGGGCTGGTGG - Intergenic
1007829061 6:44624499-44624521 CTGAAGGAGGAGGGGGCTGGCGG + Intergenic
1007975431 6:46096240-46096262 GTGTTGGGGGTGAGGGCTGGTGG - Intergenic
1008333338 6:50269503-50269525 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1008468048 6:51853083-51853105 CTCTTGCAGGGCAGGTCTGGTGG + Intronic
1008773438 6:55007555-55007577 CTGTTGCAGGGCAGGCCTGGTGG + Intergenic
1008877395 6:56344671-56344693 ATGTTGGAGGACAGGCCTGGTGG + Intronic
1009056860 6:58346627-58346649 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1009234383 6:61104945-61104967 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1009370135 6:62889244-62889266 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1009380389 6:63020858-63020880 ATGTTGAAGGTGAGGCCTGGTGG + Intergenic
1009608491 6:65905632-65905654 GTGTTAAAGGAGAGGCCTGGTGG - Intergenic
1009890225 6:69671860-69671882 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1010282789 6:74039990-74040012 CTCTTGCAAGGCAGGGCTGGTGG + Intergenic
1010331496 6:74628280-74628302 CTCTTGCAGGGCAGGCCTGGTGG - Intergenic
1010498816 6:76568664-76568686 GTGTTGCAGGTGAGGCCTGGTGG - Intergenic
1010517614 6:76791840-76791862 TTGTTGCAGGTGATGCCTGGTGG - Intergenic
1010581438 6:77601665-77601687 CTCTTGCAGGACAGGCCTGGTGG - Intergenic
1010613098 6:77980255-77980277 CTGTTGCAAGGCAGGCCTGGTGG + Intergenic
1010652292 6:78469144-78469166 CTCTTGTAGGGGAGGCCTGGTGG - Intergenic
1010659923 6:78557536-78557558 ATGTTGGAGGAGAGGCCTGGTGG - Intergenic
1010721410 6:79286604-79286626 CTCTTGTAGGGGAGGCCTGGTGG - Intergenic
1010806824 6:80246880-80246902 ATGTTGGGGGAGAGGGGTGGGGG - Intronic
1010875767 6:81103641-81103663 GTGTTGCAGGTGGGGCCTGGTGG + Intergenic
1011081816 6:83497609-83497631 CTCTTGTAGGGGAGGCCTGGTGG - Intergenic
1011220855 6:85053074-85053096 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1011257915 6:85442769-85442791 TTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1011567395 6:88691102-88691124 ATGTTGGAGGAGGGGCCTGGTGG + Intronic
1011830733 6:91368355-91368377 CTGTTGCAGGATGGGGGTGAGGG - Intergenic
1011848787 6:91600603-91600625 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
1011862220 6:91773538-91773560 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
1012058936 6:94452636-94452658 GTGTTGGAGGAGCGGCCTGGTGG + Intergenic
1012137788 6:95580011-95580033 ATCTTGCAGGAAAGGGGTGGAGG - Intronic
1012156943 6:95831009-95831031 GTGTTGGAGGAGGGGTCTGGTGG - Intergenic
1012238483 6:96845360-96845382 CTCTTGCAGGGCAGGTCTGGTGG - Intergenic
1012479630 6:99652092-99652114 CTGTTGAAGGTGGGGCCTGGTGG + Intergenic
1012561294 6:100584760-100584782 CTCTTGTAGGGCAGGGCTGGTGG + Intronic
1012984065 6:105856280-105856302 AGGTTGCAGGTGAGGTCTGGTGG - Intergenic
1013379723 6:109556189-109556211 CTCTTGCAGGGCAGGCCTGGAGG + Intronic
1013419338 6:109951791-109951813 GGGTTGGAGGAGAGGCCTGGTGG + Intergenic
1013461729 6:110380546-110380568 CTCTTGCAGGGCAGGCCTGGTGG - Intergenic
1013473032 6:110482421-110482443 ATGTTGGAGGTGAGGGCTGGTGG - Intergenic
1013803550 6:113972127-113972149 ACCTTGCAGGTGAGGGCTGGAGG + Intronic
1014035575 6:116764629-116764651 CTGGGGCAGGAGACGCCTGGCGG - Intronic
1014074123 6:117217087-117217109 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
1014082576 6:117304785-117304807 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
1014084989 6:117331806-117331828 CTGTTGCAGGGCAGGCCTGGTGG - Intronic
1014811893 6:125895859-125895881 GTGTTGGAGGTGAGGGTTGGTGG - Intronic
1014828589 6:126075358-126075380 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1015279620 6:131419193-131419215 GTGTTGGAGGAGGGGTCTGGTGG - Intergenic
1015474085 6:133639381-133639403 GTGTTGAAGGAGGGGCCTGGTGG + Intergenic
1015652317 6:135477536-135477558 GTGTTGAAGGAGGGGCCTGGTGG + Intronic
1015797983 6:137032237-137032259 CAGTGGCAGGAGACAGCTGGTGG + Intronic
1015968111 6:138715404-138715426 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1016224856 6:141722795-141722817 GTGTTGAAGGAGGGGGTTGGTGG + Intergenic
1016261409 6:142174695-142174717 GTGTTGGAGGTGAGGCCTGGTGG + Intronic
1016392505 6:143589235-143589257 GTGTTGGAGGAGGGGTCTGGTGG + Intronic
1016665225 6:146631832-146631854 CTCCTGGAGGTGAGGGCTGGAGG - Intronic
1016927280 6:149363317-149363339 TTGTTGGAGGTGAGGCCTGGTGG - Intronic
1017123792 6:151048095-151048117 GTGTTGGAGGAGGGGCCTGGTGG - Intronic
1017334889 6:153244602-153244624 ATGCTGGAGGAGAGGCCTGGTGG + Intergenic
1017422479 6:154286920-154286942 GTGTTGAAGGAGGGGCCTGGTGG + Intronic
1017711649 6:157174330-157174352 CGGTTGGGGGAGAGGGGTGGAGG + Intronic
1017841170 6:158224188-158224210 CTGAGGCAGGGGAGGGCTGGAGG - Intergenic
1017848707 6:158283747-158283769 CTGCTGAAGCAGAAGGCTGGAGG - Intronic
1017952472 6:159147645-159147667 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1017953515 6:159158907-159158929 GTGTTGGAAGAGAGGCCTGGTGG - Intergenic
1017989036 6:159470414-159470436 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
1018155844 6:160984293-160984315 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
1018369174 6:163151373-163151395 GTGTTGCTGGGGAGGGCAGGGGG - Intronic
1018377541 6:163227393-163227415 GTGTTGGAGGCGAGGCCTGGTGG - Intronic
1018458586 6:163975526-163975548 CTGCTGGAGGAGAGGGATGGAGG + Intergenic
1018465978 6:164045384-164045406 GTGTTGGAGGAGCGGCCTGGTGG - Intergenic
1018805205 6:167253962-167253984 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
1018890993 6:167981927-167981949 CTGTTGCGGGAGGGACCTGGTGG + Intergenic
1018915955 6:168132458-168132480 CTGTAGCAGGAGTTGGCTGTTGG + Intergenic
1018950242 6:168374297-168374319 CAGTGGCAGAAGAGGGATGGCGG - Intergenic
1019113329 6:169736490-169736512 CTGTTGCAGAGCAGGCCTGGTGG + Intergenic
1019127028 6:169847404-169847426 GTGTTGGAGGAGGGGCCTGGCGG + Intergenic
1019156408 6:170041874-170041896 GTGTTGCAGGTGGGGTCTGGTGG + Intergenic
1019504830 7:1385612-1385634 CTGAGGCAGGAGGGGGCCGGGGG - Intergenic
1019826271 7:3286964-3286986 GTGTTGCAGGTGTGGCCTGGTGG + Intergenic
1019975035 7:4574338-4574360 ACGTTGGAGGAGAGGCCTGGTGG + Intergenic
1020527605 7:9282338-9282360 GTGTTGGAGGTAAGGGCTGGTGG - Intergenic
1020630854 7:10637726-10637748 TTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1020696385 7:11419263-11419285 GTGTTGCAGGAGGGGCCTGGTGG + Intronic
1020719290 7:11721275-11721297 ATGTTGGAGGAGGTGGCTGGTGG + Intronic
1020744842 7:12068198-12068220 CTGTCTGAGGAGAGGGCTTGGGG - Intergenic
1020809149 7:12830111-12830133 ATGTTGCAGGTGGGGCCTGGTGG - Intergenic
1020973362 7:14976001-14976023 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
1021055369 7:16040969-16040991 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1021100655 7:16584159-16584181 CTGATGCTGGACAGGACTGGGGG + Intergenic
1021200992 7:17728513-17728535 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1021245064 7:18251351-18251373 CTGTTGGAGAAGAGTGGTGGGGG + Intronic
1021332402 7:19354947-19354969 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1021761116 7:23903961-23903983 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1021930517 7:25576932-25576954 CTGTTGGAGGAGGGGTCTGGTGG - Intergenic
1022033133 7:26510281-26510303 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
1022442929 7:30448560-30448582 CTGGTGCAGGATGGGTCTGGCGG - Intronic
1022569393 7:31436819-31436841 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1022682985 7:32567542-32567564 CTGCCGCTGGAGAGGGCTGCTGG - Intronic
1023455826 7:40337925-40337947 CTCTTGTAGGACAGGCCTGGTGG + Intronic
1024135860 7:46407277-46407299 CTGTTGCAGGAGAGTGTTCTTGG + Intergenic
1024181843 7:46903174-46903196 GTGTTGGAGGTGAGGCCTGGAGG - Intergenic
1024373443 7:48611703-48611725 GTGTTGGAGGAGGGGCCTGGTGG - Intronic
1024581731 7:50806182-50806204 CTGTTGCTGGTGAGTGCAGGGGG + Intergenic
1024799456 7:53059348-53059370 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1024860664 7:53836022-53836044 ATGCTGGAGGAGAGGACTGGTGG + Intergenic
1025142388 7:56476949-56476971 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
1025602166 7:63011273-63011295 TTGTTGCACGAGGGGGCAGGTGG + Intergenic
1025611028 7:63075753-63075775 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1025939266 7:66062206-66062228 GTGTTGGGGGAGAGAGCTGGTGG - Intergenic
1026054343 7:66971513-66971535 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1026069384 7:67104501-67104523 ATGTTGGAGGAGGGGCCTGGTGG - Intronic
1026125831 7:67578763-67578785 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1026302838 7:69112991-69113013 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1026305585 7:69137740-69137762 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1026354307 7:69544118-69544140 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
1026554232 7:71392058-71392080 ATGTTGGAGGTGAGGCCTGGTGG - Intronic
1026707519 7:72707817-72707839 ATGTTGGAGGAGGGGCCTGGTGG + Intronic
1026838672 7:73655623-73655645 CTGTTGTGGGAGAGACCTGGTGG - Intergenic
1027162545 7:75813264-75813286 ACGTGGCAGGAGAGGGGTGGGGG - Intronic
1027427891 7:78080528-78080550 CTGTTGTGGGAGAGGGCTACTGG - Intronic
1027513392 7:79110791-79110813 GTGTTGGAGGTGAGGACTGGTGG + Intronic
1027627296 7:80562357-80562379 CTCTTGCAGGGCAGGCCTGGTGG + Intronic
1027690488 7:81338695-81338717 GTGTTGAAGGAGAGACCTGGTGG + Intergenic
1028040737 7:86050914-86050936 GTGTTGGAGGAGAGGCCTGCTGG - Intergenic
1028141150 7:87275761-87275783 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1028337248 7:89673117-89673139 CTCTTGTAGGACAGGCCTGGTGG + Intergenic
1028457187 7:91051249-91051271 ATGTTGGAGGTGAGGCCTGGTGG - Intronic
1028459380 7:91073467-91073489 CTCTTGCAAGACAGGCCTGGTGG - Intronic
1028858061 7:95614498-95614520 CTTTTGCAGGGCAGGTCTGGTGG - Intergenic
1029146103 7:98447261-98447283 CTGCTGAAGGTCAGGGCTGGTGG + Intergenic
1029226205 7:99030425-99030447 CTGTTGGGGGAGGGGGATGGGGG - Exonic
1029327092 7:99819106-99819128 ATGTTGGAGGAGGGGTCTGGTGG + Intergenic
1029509902 7:100987554-100987576 GTGTTGCAGGAGGGGCCTTGTGG + Intronic
1029551671 7:101239966-101239988 CTGTTGAGGGGCAGGGCTGGCGG - Intronic
1029963528 7:104713585-104713607 GTGTTGCGGGAGGGGTCTGGTGG - Intronic
1030139826 7:106293114-106293136 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1030250815 7:107442092-107442114 ATGTTGGAGGAGGGGCCTGGTGG + Intronic
1030498895 7:110334362-110334384 CTGTTGGGGCAGAGGGTTGGTGG - Intergenic
1030523814 7:110629837-110629859 CTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1031222341 7:118985123-118985145 CTGTTGTGGGAGGGGCCTGGTGG + Intergenic
1031311792 7:120207755-120207777 CTATTGCAGGGCAGGCCTGGTGG - Intergenic
1031419946 7:121539492-121539514 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
1031548791 7:123083505-123083527 CTCTTGTAGGACAGGCCTGGTGG + Intergenic
1031574549 7:123399780-123399802 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
1031583358 7:123504697-123504719 GTGTTGGAGGAGAGGTCTGGTGG - Intronic
1032124949 7:129187026-129187048 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1032238029 7:130141347-130141369 CTGTCGCAGGAGAGTGCCCGGGG + Intergenic
1032730905 7:134642019-134642041 CTGTTGTAGGAGGGACCTGGTGG + Intergenic
1032752438 7:134854859-134854881 TTGTTGGAGGAGGGGCCTGGTGG + Intronic
1032887614 7:136158521-136158543 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
1033671224 7:143495152-143495174 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1033784639 7:144716350-144716372 ATGTTGAAGGTGAGGCCTGGTGG + Intronic
1033791765 7:144798743-144798765 CTCTTGCAAGACAGGCCTGGTGG - Intronic
1033798347 7:144873546-144873568 GTGTTGCGGGAGAGACCTGGTGG + Intergenic
1034113641 7:148562977-148562999 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1034255448 7:149722399-149722421 CTGTTGCAGGAGAAGACAAGAGG - Intronic
1034376206 7:150646942-150646964 GTGTTGGAGGAGGGGTCTGGTGG + Intergenic
1034542185 7:151765401-151765423 ATGTTGGAGGAGGGGCCTGGTGG - Intronic
1034727681 7:153354129-153354151 GTGTTGAAGGAGGGGCCTGGTGG + Intergenic
1034929181 7:155147765-155147787 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1034978465 7:155461181-155461203 CTGTGGCTGGAGAAGGCTGGGGG - Intronic
1035563339 8:625112-625134 ATGTTGGAGGAGGGAGCTGGTGG - Intronic
1035674211 8:1443469-1443491 CTCTTGCAGGAGAAGACTGAGGG - Intergenic
1035822612 8:2610607-2610629 GTGTTGGAGGAGGGGCCTGGCGG + Intergenic
1035840914 8:2811172-2811194 CCCTTTCAGGAGATGGCTGGAGG - Intergenic
1036037772 8:5038973-5038995 GTGTTGGAGGTGAGGACTGGTGG + Intergenic
1036088620 8:5640306-5640328 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1036117179 8:5971196-5971218 ATGTTGAGGGAGAGGCCTGGTGG - Intergenic
1036158262 8:6362613-6362635 CAGTAGCAGGAGAGGAGTGGAGG - Intergenic
1036406436 8:8459613-8459635 CTGTTGCGGGAGGGACCTGGTGG - Intergenic
1036530049 8:9576674-9576696 GTGTTGAAGGAGGGGCCTGGTGG - Intronic
1036637043 8:10558336-10558358 GTGTTGAAGGTGAGGTCTGGTGG - Intergenic
1036695262 8:10970083-10970105 CTCTCGCAGGAGTGGGCTGTTGG + Intronic
1037086473 8:14856989-14857011 GTGTTGGAGGAGGGGCCTGGAGG + Intronic
1037181988 8:16018335-16018357 CTTTTGTAGGAGAGTGGTGGTGG - Intergenic
1037380798 8:18283525-18283547 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1037624768 8:20597111-20597133 GTGTTGAAGGAGGGGCCTGGTGG + Intergenic
1037675200 8:21045104-21045126 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1037694487 8:21211370-21211392 CTGTTGACGGAGATGCCTGGTGG - Intergenic
1038084560 8:24180354-24180376 CTGTTCCAGCAGAGGTCTAGGGG + Intergenic
1038163101 8:25059246-25059268 CTGTGGCAGGTGATGGGTGGTGG - Intergenic
1038275131 8:26115048-26115070 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1038376026 8:27041358-27041380 ATGTTGAAGGTGAGGCCTGGTGG + Intergenic
1038396248 8:27247654-27247676 CAGTTCCAGGAGAGGTTTGGTGG - Intronic
1038431077 8:27500125-27500147 ATGTTGGAGGAGGGGGTTGGTGG + Intronic
1038660062 8:29489650-29489672 ATGTTGCAGGTGGGGTCTGGTGG - Intergenic
1038662631 8:29510408-29510430 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1038723428 8:30058521-30058543 ATGTTGCAGGTGGGGCCTGGTGG + Intergenic
1039178294 8:34833998-34834020 ATGTTGAAGGAGAGGTCTTGTGG + Intergenic
1040062490 8:43115839-43115861 ATGGAGCAGGAGAGAGCTGGAGG - Intronic
1040807962 8:51415543-51415565 GTGTTGGAGGAGGGGCCTGGTGG - Intronic
1041216837 8:55609013-55609035 GTGTTGGAGGAGTGGCCTGGTGG - Intergenic
1042404896 8:68393328-68393350 CTGCTGCAGGAAATGGATGGAGG + Intronic
1042412875 8:68484308-68484330 ATGTTAGAGGTGAGGGCTGGTGG - Intronic
1042538570 8:69884277-69884299 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1042585790 8:70336734-70336756 ATGTTGGAGGAGGGGCCTGGTGG - Intronic
1042658909 8:71132629-71132651 CTGTTGTATGAGAGAGCTGTTGG + Intergenic
1042887205 8:73565178-73565200 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
1043013792 8:74912604-74912626 GTGTTGCAGGAGGGGCCTGGTGG + Intergenic
1043223651 8:77697877-77697899 CTCTTGCAGGGCAGGCCTGGTGG + Intergenic
1043704840 8:83335298-83335320 GTGTTGAAGGAGGGGCCTGGTGG + Intergenic
1043825793 8:84927115-84927137 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1044004156 8:86921716-86921738 GTGTTGTAGGAGAGACCTGGTGG - Intronic
1044189473 8:89297785-89297807 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1044306797 8:90647705-90647727 TTGTTGGAGGAGAGGCCTGGTGG - Intronic
1044310654 8:90688114-90688136 GTATTGGAGGAGAGGTCTGGTGG - Intronic
1044550795 8:93510381-93510403 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1044927050 8:97218386-97218408 GTGTTGCAGGAGGGGCTTGGTGG - Intergenic
1045439077 8:102192080-102192102 CTGTTGGAGGTGAGGCCTAGTGG - Intergenic
1045561678 8:103270254-103270276 GTGTTGGAGGAGGGGTCTGGTGG + Intergenic
1045561957 8:103272247-103272269 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1045674680 8:104593898-104593920 GTGTTGGAGGAGAGGCCTGGAGG + Intronic
1045778545 8:105835848-105835870 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1046185727 8:110714020-110714042 CTGTTGAAGGAGGGGCCTGATGG + Intergenic
1046517355 8:115280610-115280632 GTGTTGGAGGAGAGGCCTGGTGG - Intergenic
1046616387 8:116482157-116482179 CAGCAGCAGGAGAGGGCAGGAGG - Intergenic
1047627012 8:126666795-126666817 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1048010024 8:130448037-130448059 CTGCTGAAGGAGAGGGCCGAAGG + Intergenic
1048023230 8:130559935-130559957 GTGTTGAAGGAGAGGCCTGGTGG + Intergenic
1048111211 8:131470934-131470956 GTGTTGAGGGAGAGAGCTGGTGG + Intergenic
1048207159 8:132424411-132424433 CTGTCGAATGAGAGGGTTGGGGG - Intronic
1048375862 8:133821980-133822002 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1049363147 8:142223878-142223900 CTGTTGCAGAAATGAGCTGGTGG - Intronic
1049521904 8:143095616-143095638 CCGTAGCAGGAGAAAGCTGGGGG - Intergenic
1049653020 8:143784217-143784239 GTGTTGCAGGAGGGGCCTGGGGG + Intergenic
1049770486 8:144378314-144378336 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
1050109730 9:2201900-2201922 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1050166061 9:2765881-2765903 GTGTTGGAGGTGAGGCCTGGTGG - Intronic
1050284334 9:4085627-4085649 CTGTTGGAGGTGGGGCCTGGTGG + Intronic
1050378409 9:4997571-4997593 ATGTTGGAGGTGAGGCCTGGTGG - Intronic
1050415970 9:5418355-5418377 TTGTGGCTGGAGAGGGCTGCAGG - Intronic
1050432982 9:5580827-5580849 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1050964610 9:11782878-11782900 GTGTTGCAGGAGGGACCTGGTGG - Intergenic
1051299215 9:15629992-15630014 CTCTTGCAGGGCAGGCCTGGTGG - Intronic
1051705804 9:19878547-19878569 CTGTTGGAGGTGGGGCCTGGTGG + Intergenic
1051715282 9:19976302-19976324 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1052026441 9:23578104-23578126 CTTTTGGAGGAGAGGGGAGGTGG - Intergenic
1052090346 9:24320017-24320039 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1052147314 9:25065997-25066019 GTGTTGGAGGAGAGGTCTGATGG - Intergenic
1052208441 9:25871369-25871391 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1052225087 9:26076310-26076332 CTCTTGCAGGGCAGGTCTGGTGG + Intergenic
1052311624 9:27074804-27074826 CTGTGGCAGGGGATGGCTGGAGG + Intergenic
1052546852 9:29890587-29890609 CTCTTGCAGGGCAGGCCTGGTGG - Intergenic
1052662834 9:31457985-31458007 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1052664576 9:31478331-31478353 ATGTTGCAAGAGGGGCCTGGGGG - Intergenic
1052727175 9:32243067-32243089 ATGTTGAAGGAGGGGCCTGGTGG - Intergenic
1053469036 9:38332509-38332531 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1053497554 9:38559431-38559453 ATGTTGCAGGTGTGGCCTGGTGG - Intronic
1053548257 9:39046641-39046663 CTGTTGCAGGAGGTGCTTGGAGG - Intergenic
1053663624 9:40301899-40301921 ATGTTGCAGGTGGGGCCTGGTGG + Intronic
1053685136 9:40514180-40514202 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1053812377 9:41866679-41866701 CTGTTGCAGGAGGTGCTTGGAGG - Intergenic
1053935097 9:43142473-43142495 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1054278593 9:63110783-63110805 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1054298227 9:63349637-63349659 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1054375748 9:64448132-64448154 ATGTTGCAGGTGGGGCCTGGTGG + Intergenic
1054396245 9:64654154-64654176 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1054430888 9:65159349-65159371 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1054499493 9:65862172-65862194 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1054520991 9:66074386-66074408 ATGTTGCAGGTGGGGCCTGGTGG - Intergenic
1054618218 9:67320760-67320782 CTGTTGCAGGAGGTGCTTGGAGG + Intergenic
1054717649 9:68572486-68572508 GTGTTGGAGGAGGGGCCTGGAGG - Intergenic
1054889543 9:70235962-70235984 CTCTTGTAGGACAGGCCTGGTGG - Intergenic
1055014184 9:71597777-71597799 CTCTTGTAGGACAGGCCTGGTGG - Intergenic
1055140115 9:72867590-72867612 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
1055168016 9:73220049-73220071 GTGTTGCAGGAGGGACCTGGTGG + Intergenic
1055351994 9:75399152-75399174 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1055352102 9:75400084-75400106 GTGTTGGAGGAGAGGCTTGGTGG - Intergenic
1055599004 9:77895730-77895752 GTGTTGCAGGAGGGACCTGGTGG + Intronic
1055663497 9:78530850-78530872 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
1055729146 9:79262818-79262840 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1055877425 9:80960223-80960245 ATGTTGCAGGAGGGACCTGGTGG + Intergenic
1056056825 9:82833440-82833462 CTGTTGGAGGTGGGGCCTGGTGG + Intergenic
1056637026 9:88339673-88339695 CCGTTGCAGGAGAGGACGTGAGG - Intergenic
1056978111 9:91279710-91279732 GTGTTGGAGGAGGGGCCTGGTGG - Intronic
1057135150 9:92682314-92682336 TTGTTGCAAGTGGGGGCTGGGGG - Intergenic
1057631559 9:96722975-96722997 ATGTTGAAGGAGGGGCCTGGCGG - Intergenic
1057677027 9:97143913-97143935 ATGTTGCAGGTGTGGCCTGGTGG - Intergenic
1057758694 9:97855677-97855699 CTGTTACACTAGAGGGCTGCAGG + Exonic
1058141480 9:101360713-101360735 GTGTTGGAGGTGAGGCCTGGTGG - Exonic
1058234368 9:102470876-102470898 GTGTTGGAGGTGAGGCCTGGTGG - Intergenic
1058652896 9:107193684-107193706 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
1058925251 9:109656710-109656732 CTGTTGCAGGTGAGAACTGAAGG + Intronic
1059095082 9:111404474-111404496 ATGTTGGAGGAGAGGCCTGGTGG + Intronic
1059262502 9:112992258-112992280 CTCTTGCAAGGGAGGCCTGGTGG + Intergenic
1059453790 9:114387293-114387315 CTGCTGCTGGAGCGGGCTGGGGG - Intronic
1059475217 9:114541065-114541087 GTGTTGGAGGTGAGGCCTGGTGG + Intergenic
1059681757 9:116592480-116592502 CTGTTGGAGGCGAGGGCTGGTGG - Intronic
1059746016 9:117202515-117202537 CTGTTGCAGGGCAGGCCTGGTGG + Intronic
1059779989 9:117516029-117516051 CTGTTGGAGGTGGGGCCTGGTGG - Intergenic
1059835750 9:118150196-118150218 CTGTAGCAGGAGATAGCAGGAGG + Intergenic
1060255629 9:122027263-122027285 GTGTTGGAGGTGAGGCCTGGTGG - Intronic
1060401886 9:123354251-123354273 CGGCTGCAGGACAGTGCTGGGGG + Intergenic
1060436013 9:123593828-123593850 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
1060486791 9:124052663-124052685 GTCTTGCAGGGGAGGGCTGATGG + Intergenic
1060749517 9:126159785-126159807 ACTTTGCAGGAAAGGGCTGGGGG - Intergenic
1060890177 9:127183166-127183188 GTGTTGGAGGCGAGGCCTGGTGG - Intronic
1060931231 9:127490796-127490818 CTGTTGCAGGGGAGAGCAGAGGG - Intronic
1060978205 9:127777554-127777576 CTGGGGCAGCAGAGGGATGGGGG - Intronic
1061618640 9:131796539-131796561 CTGTTGGAGGTGGGGTCTGGTGG - Intergenic
1061816730 9:133201824-133201846 CTGTCCCATGAGAGGGATGGGGG + Intergenic
1061910043 9:133717560-133717582 CAGATGCATTAGAGGGCTGGTGG + Intronic
1062052460 9:134454678-134454700 CTGAGGCAGGAGAGGGGAGGAGG - Intergenic
1062137834 9:134939024-134939046 CTGCAGCAGCAGAGGGGTGGGGG - Intergenic
1062444361 9:136587484-136587506 CTGCTGGAGGAGGGGGCTGTGGG + Intergenic
1185673161 X:1827307-1827329 CTGTTACAGGTGAGGCCAGGTGG - Intergenic
1185683256 X:1906365-1906387 GTGATGGAGGAGAGGTCTGGTGG + Intergenic
1185913139 X:4004610-4004632 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1185916512 X:4041418-4041440 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
1185985200 X:4824924-4824946 TTGTTGTGGGAGAGGCCTGGTGG + Intergenic
1186001937 X:5022288-5022310 GTGTTGGAGGAGAGGTTTGGTGG + Intergenic
1186053446 X:5624460-5624482 GTGTTGAAGGAGAGGCCTGGTGG + Intergenic
1186074477 X:5863138-5863160 GTGTTGAAGGAGGGGCCTGGTGG + Intronic
1186488429 X:9952365-9952387 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1186647086 X:11518603-11518625 CTGTTGCAAGGGAGGCCTTGAGG - Intronic
1186742749 X:12535008-12535030 ATGTTGTAGGAGAGACCTGGTGG + Intronic
1186809033 X:13168849-13168871 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1186977580 X:14924616-14924638 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1187209947 X:17219723-17219745 CTGTTGGAGGAGGAGCCTGGTGG + Intergenic
1187619278 X:21031896-21031918 GTGTTGCAGGAGGGACCTGGTGG - Intergenic
1187619629 X:21036945-21036967 GTGTTGCAGATGAGGCCTGGTGG - Intergenic
1187628819 X:21145395-21145417 ATGTTGAAGGAGGGAGCTGGTGG - Intergenic
1187650129 X:21392608-21392630 GTGTTGGAGGAGGGGCCTGGTGG - Intronic
1188092370 X:25978727-25978749 CTCTTGCAGGGCAGGCCTGGTGG - Intergenic
1188426075 X:30048506-30048528 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
1188500695 X:30822594-30822616 GTGTTGAAGGAGGGGCCTGGTGG - Intergenic
1188513372 X:30960051-30960073 GTGTTGGAGGAGGGGCCTGGTGG - Intronic
1188514098 X:30966552-30966574 CTGTTGGAGGGGAAGGTTGGGGG + Intronic
1188657477 X:32716230-32716252 GTGTTGGAGGAGGGGCCTGGTGG + Intronic
1188791161 X:34409526-34409548 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1188959421 X:36471831-36471853 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1189275091 X:39779642-39779664 CTGGAGGAGGAGCGGGCTGGGGG - Intergenic
1189285495 X:39849487-39849509 CTGTTGGAGGTGGGGCCTGGTGG + Intergenic
1189656329 X:43248661-43248683 ATGTTGGAGGAGTGGCCTGGTGG + Intergenic
1189748680 X:44196158-44196180 CTGTGGCAGGCCAAGGCTGGTGG - Intronic
1189770841 X:44425503-44425525 CTCTTGTAGGGGAGGCCTGGTGG + Intergenic
1189934798 X:46056532-46056554 CTCTTGTAGGGGAGGCCTGGTGG + Intergenic
1189949461 X:46213903-46213925 GTGTTGGAGGTGGGGGCTGGTGG - Intergenic
1190013981 X:46810788-46810810 GTGTTGTAGGAGGGGCCTGGTGG - Intergenic
1190269540 X:48852104-48852126 CTGTTGTGGGAGAGACCTGGTGG - Intergenic
1190366642 X:49700888-49700910 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1190368358 X:49718666-49718688 ATGTTGGAGGAGGGGACTGGTGG - Intergenic
1190411825 X:50144209-50144231 GTGTTGAAGGAGGGGCCTGGTGG - Intergenic
1191769085 X:64735668-64735690 GTGTTGAAGGTGAGGCCTGGTGG - Intergenic
1192073007 X:67961154-67961176 GTGTTGGAGGTGAGGTCTGGTGG + Intergenic
1192101233 X:68266493-68266515 CTCTTGTAGGGGAGGCCTGGTGG - Intronic
1192399574 X:70821354-70821376 GTGTTGGGGGAGAGGCCTGGTGG + Intronic
1192718431 X:73667526-73667548 CTCTTGCAGGGGAAGTCTGGAGG + Intronic
1192793451 X:74406704-74406726 ATGTTGGAGGTGAGGCCTGGTGG - Intergenic
1192847065 X:74917141-74917163 ATGTTGGAGGACAGGCCTGGTGG + Intronic
1192858624 X:75040759-75040781 CTGCTGCTGCAGAGGGATGGGGG + Intergenic
1192910626 X:75600675-75600697 CTCTTGTAGGGGAGGCCTGGTGG + Intergenic
1192931542 X:75811598-75811620 GTGTTGGAGGAGAGGCCTTGAGG + Intergenic
1192952120 X:76028075-76028097 CTCTTGCAAGGGAGGCCTGGTGG - Intergenic
1192972970 X:76253075-76253097 TTGTTGCAGATGAGGCCTGGTGG + Intergenic
1193048183 X:77075291-77075313 CTCTTGCAGGGCAGGCCTGGTGG + Intergenic
1193090836 X:77492541-77492563 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
1193200749 X:78687550-78687572 ATGTTAGAGGAGAGGCCTGGTGG + Intergenic
1193453116 X:81695483-81695505 CTCTTGCAAGACAGGCCTGGTGG + Intergenic
1193466568 X:81854442-81854464 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1193527684 X:82612991-82613013 ATGTTGGAGGTGAGGCCTGGAGG + Intergenic
1193930417 X:87545313-87545335 GTGTTGAAGGAGGGGCCTGGTGG + Intronic
1193965009 X:87974650-87974672 ATGTTGGAGGAGGGGCCTGGTGG + Intergenic
1194056579 X:89142214-89142236 GAGTTGCAGGAGAGGGGTGTGGG + Intergenic
1194269368 X:91791532-91791554 GTGTTGAAGGAGGGGCCTGGTGG - Intronic
1194300406 X:92180283-92180305 GTGTTGAAGGAGGGGCCTGGTGG - Intronic
1194454074 X:94080560-94080582 GTGTTGGAGGAGAGGCCTGGTGG + Intergenic
1194764303 X:97831421-97831443 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
1195217089 X:102712859-102712881 CTGTGCCCGGAGAGGGCTGTGGG + Intronic
1195281967 X:103344918-103344940 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1195814779 X:108873015-108873037 ATGTTGAAGGATGGGGCTGGGGG + Intergenic
1195844050 X:109207510-109207532 CTCTTGCAAGACAGGCCTGGTGG + Intergenic
1195989912 X:110672188-110672210 ATGTTGGAGGAGGGGCCTGGTGG - Intergenic
1196004893 X:110825397-110825419 GTGTTGCAGGTGAGGCCTGGTGG + Intergenic
1196081434 X:111637109-111637131 ATGTTGGAGGAGTGGCCTGGTGG + Intergenic
1196582422 X:117393226-117393248 ATGTTGTAGGAGGGGCCTGGTGG - Intergenic
1197106243 X:122720129-122720151 TTGTGGCAGGAGAGGGATGAGGG - Intergenic
1197346041 X:125326666-125326688 CTCTTCCAGGAGAAAGCTGGGGG - Intergenic
1197366655 X:125572253-125572275 GTTTTGGAGGAGAGGCCTGGTGG - Intergenic
1197403730 X:126025899-126025921 CTATTGCAGGGCAGGCCTGGTGG + Intergenic
1197494115 X:127155688-127155710 TTCTTGCAGGATAGGTCTGGTGG + Intergenic
1197902363 X:131388106-131388128 TTGTTGGAGGAGGGGCCTGGTGG + Intronic
1197930437 X:131689453-131689475 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1198257037 X:134932872-134932894 CTGGTGTGGGGGAGGGCTGGTGG - Intergenic
1198446891 X:136726352-136726374 CTCTTCCATGTGAGGGCTGGAGG - Intronic
1198586729 X:138129535-138129557 CAGGTGCTGGGGAGGGCTGGAGG + Intergenic
1198660670 X:138964887-138964909 GTGTTGGAGGCGAGGCCTGGTGG - Intronic
1199077772 X:143544351-143544373 GTGTTGAAGGAGGGGCCTGGTGG - Intergenic
1199109293 X:143911052-143911074 GTGTTGGAGGAGGGGCCTGGTGG - Intergenic
1199176514 X:144793738-144793760 GTGTTGGAGGAGGGGCCTGGCGG - Intergenic
1199373888 X:147084256-147084278 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1199463089 X:148105235-148105257 GTGTTGGAGGAGGGGCCTGGTGG + Intergenic
1199800946 X:151250187-151250209 CAGTCTCAGGAGAGAGCTGGAGG - Intergenic
1200238902 X:154483468-154483490 GTAGTGGAGGAGAGGGCTGGAGG - Intergenic
1200255860 X:154582471-154582493 GTGTTGGAGGAGGGGACTGGTGG + Intergenic
1200261909 X:154621932-154621954 GTGTTGGAGGAGGGGACTGGTGG - Intergenic
1200372526 X:155741810-155741832 CTCTTGCAAGGGAGGCCTGGTGG - Intergenic
1200586588 Y:5012517-5012539 GTGTTGAAGGAGGGGCCTGGTGG - Intronic
1201394566 Y:13535009-13535031 CTCTTGTAGGGCAGGGCTGGTGG + Intergenic
1201519472 Y:14857636-14857658 CAGTTGGAGGAGAGGCCTAGTGG + Intergenic
1201533896 Y:15023965-15023987 ATGTTGGAGGTGAGGCCTGGTGG + Intergenic
1201734590 Y:17244678-17244700 CTGCTGCAGGAGTTTGCTGGGGG + Intergenic
1201864760 Y:18637886-18637908 CAGTTATAGGAGAAGGCTGGAGG - Intergenic
1201868562 Y:18682492-18682514 CAGTTATAGGAGAAGGCTGGAGG + Intergenic
1201992984 Y:20049343-20049365 CTCTTGTAAGAGAGGCCTGGTGG - Intergenic
1202391091 Y:24371270-24371292 CTGTTGCTGGACAGGCATGGGGG + Intergenic
1202479693 Y:25298846-25298868 CTGTTGCTGGACAGGCATGGGGG - Intergenic