ID: 1162808243

View in Genome Browser
Species Human (GRCh38)
Location 19:13150078-13150100
Sequence TACCCAAGCCAGCCAGTGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162808243_1162808253 21 Left 1162808243 19:13150078-13150100 CCGGGCACTGGCTGGCTTGGGTA 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1162808253 19:13150122-13150144 CCGTCGTTGTCACTCACCCTCGG 0: 1
1: 0
2: 0
3: 2
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162808243 Original CRISPR TACCCAAGCCAGCCAGTGCC CGG (reversed) Intronic
900129052 1:1079978-1080000 TCCCCAGGCCTGGCAGTGCCAGG - Intergenic
900188740 1:1344568-1344590 TCCCCAGGCCACCCAGGGCCAGG + Intronic
900466828 1:2829856-2829878 TACCCCAGGCAGCCTGGGCCTGG - Intergenic
900647847 1:3717159-3717181 TGCCCAAACCTGCCCGTGCCGGG + Intronic
901535849 1:9882678-9882700 TACCCAACCAAGCCCCTGCCTGG - Intronic
902244398 1:15110784-15110806 TACACAAGACACCCAGTGGCAGG - Intronic
902993002 1:20202759-20202781 TGCCCCAGGCACCCAGTGCCTGG + Intergenic
903256729 1:22107451-22107473 AACCCAAAGCAGCCACTGCCAGG - Intergenic
905455326 1:38084342-38084364 TCCCCAAGGCAGTCAGTCCCTGG - Intergenic
905474618 1:38217469-38217491 TGCCCAAGCAAGCCTGTGGCTGG - Intergenic
912707435 1:111925344-111925366 CACCCAAGCTAGCAAGTGGCTGG + Intronic
914672529 1:149882384-149882406 TGCCCATGCCATCCACTGCCTGG + Intronic
919465804 1:197920649-197920671 AACCCAAGCCACTCAGTTCCGGG + Intronic
919881993 1:201906940-201906962 TACCCAGGACAGCTGGTGCCAGG - Intronic
922770664 1:228181210-228181232 TTCCCAAGTCGGCCAGTTCCTGG + Exonic
922930040 1:229381881-229381903 TGCCCAAGGGTGCCAGTGCCAGG + Intergenic
924415323 1:243850801-243850823 CCCCCTAGCCAGCCAGAGCCGGG + Intronic
1063617150 10:7610258-7610280 TTCCCAAGCCAGGCAGGTCCTGG + Intronic
1064119146 10:12604198-12604220 CACCCAACCAAGCCTGTGCCTGG + Intronic
1067667059 10:48287867-48287889 GACCCCAGCCAGACAGTGCTTGG + Intergenic
1067695990 10:48536025-48536047 GACCCAGGCCAGCCTCTGCCGGG - Intronic
1069737204 10:70664658-70664680 AACCCCAGGCAGCCAATGCCAGG + Intergenic
1071570373 10:86693355-86693377 GGCCCAAGGCAGACAGTGCCGGG - Intronic
1072606137 10:96984362-96984384 TGCCCACTCCAGCCAGTACCCGG + Exonic
1072762082 10:98064979-98065001 TCCCAAAGCCAAACAGTGCCTGG + Intergenic
1072790560 10:98314686-98314708 TACCCAGCACAGCCAGTGCAAGG + Intergenic
1073523282 10:104155195-104155217 CACCCAGGGCAGCCAGTGACCGG - Intronic
1073553968 10:104429830-104429852 TGTCCAAGCCAGCCAAGGCCTGG - Intronic
1077061080 11:618167-618189 TTCCCATGCCAACCTGTGCCAGG + Intronic
1077240847 11:1509758-1509780 TTCCAATGACAGCCAGTGCCAGG + Intergenic
1077252939 11:1568630-1568652 TACCCACCCCAGCAGGTGCCCGG + Intronic
1080104415 11:28496947-28496969 AACTCAAGGGAGCCAGTGCCAGG + Intergenic
1081577695 11:44329604-44329626 CACCCAAGCTAGTAAGTGCCAGG + Intergenic
1081913968 11:46719271-46719293 TACACAGGGCAGCCAGGGCCAGG - Exonic
1082001348 11:47395150-47395172 TCCCCAGGCCAGCCAGGGCCAGG + Intergenic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1083203038 11:61131824-61131846 TACCCAGGCCAGGCAGGCCCCGG + Exonic
1083877118 11:65530155-65530177 TGCCCAATCCAGCCAGGGCAGGG + Intronic
1084455350 11:69265058-69265080 GCCCCAAGGCACCCAGTGCCGGG - Intergenic
1088459668 11:110069315-110069337 TACCTCAGCCAGCCATTGCCAGG + Intergenic
1091875508 12:3930278-3930300 TCTCCAAGCCAGGCAGGGCCAGG - Intergenic
1092959050 12:13578489-13578511 TACCCATTCCAGTCAGAGCCAGG + Intronic
1100407913 12:94287038-94287060 TAACCATGGCAGCCAGTGCCTGG + Intronic
1102205977 12:111091183-111091205 TTCCCACTCCAGCCAGGGCCAGG + Intronic
1102454090 12:113060891-113060913 TACCCAACCCAGCTAGGTCCCGG - Intronic
1103627896 12:122234585-122234607 TAAACAAGCCAGCCATGGCCAGG - Intronic
1105044470 12:132990679-132990701 CACCCAAACCAGAAAGTGCCAGG - Intronic
1108707964 13:53007063-53007085 TACCCAGGCCAGCCTGGGCAGGG + Intergenic
1112476985 13:99740398-99740420 TATCCAAGCCAGCGAGTGAGTGG - Intronic
1113529050 13:111006647-111006669 TACCCAGGCCACTCTGTGCCCGG + Intergenic
1115506651 14:34099756-34099778 TCACCCAGCCTGCCAGTGCCAGG + Intronic
1119323632 14:73745894-73745916 TTCCCAATCCAGACAGTCCCTGG + Intronic
1119582957 14:75804065-75804087 CTCCCCAACCAGCCAGTGCCCGG + Intronic
1121316139 14:92962030-92962052 TGGCGAAGCCACCCAGTGCCTGG + Intronic
1121348882 14:93157069-93157091 TACCCCAGCTAGGCAGTCCCTGG - Intergenic
1122088348 14:99322263-99322285 CACCAAAGCCACCCAGAGCCAGG + Intergenic
1122130034 14:99599592-99599614 TACCAAAGGCAGCCAAGGCCAGG + Intronic
1122603388 14:102932125-102932147 AGCCCCAGCCAGGCAGTGCCAGG - Intronic
1122882004 14:104694382-104694404 TGCTCCAGGCAGCCAGTGCCAGG - Intronic
1123047829 14:105527120-105527142 TACCCCGGCAAGCCAGAGCCCGG - Intronic
1124844192 15:33274883-33274905 TAGCAAAGCCAGCCAGAGCCGGG + Intergenic
1126654771 15:50965365-50965387 CACCCAATCCTGCCACTGCCAGG - Intronic
1127934716 15:63625938-63625960 TTACCAAGCCAGTCTGTGCCTGG + Intronic
1128083056 15:64867600-64867622 TAGCCAAGCCACCTACTGCCAGG + Exonic
1129072600 15:72963549-72963571 TACAAATGCCAGCCTGTGCCAGG - Intergenic
1129167498 15:73787072-73787094 TACCGCAGCCCTCCAGTGCCAGG + Intergenic
1129264445 15:74386415-74386437 TCTGCAAGCCAGCCGGTGCCGGG - Intergenic
1129365238 15:75050048-75050070 TACCCATGCCACTGAGTGCCTGG + Exonic
1130681831 15:86003688-86003710 CACCCAAGCCAGCTATTGTCTGG - Intergenic
1131463624 15:92637418-92637440 CACCAAAGCCAGCCGGGGCCAGG + Intronic
1131658405 15:94485671-94485693 GACCCAAGCCAGCCAATTCTTGG - Intergenic
1132515322 16:363332-363354 CACACAATCCAGCCCGTGCCTGG + Intergenic
1132547542 16:540270-540292 TACACCAGCCAGCCGCTGCCGGG - Intronic
1133154465 16:3863305-3863327 AACCCAAGCAAGACAGGGCCAGG + Intronic
1139436897 16:66941656-66941678 AACCCAAGCCCACAAGTGCCTGG + Intronic
1140852032 16:78943921-78943943 TACCCAAGGCCTCCATTGCCTGG + Intronic
1141171924 16:81696949-81696971 TACCCAAGGCAGCTAAAGCCTGG + Intronic
1141733010 16:85834857-85834879 GACCCAAGCAAGCCAGTGAGGGG + Intergenic
1142989889 17:3723580-3723602 TACCCCTGCCGGCCAGTGCCGGG - Intronic
1143175041 17:4950559-4950581 TCTCCAGGCCAGCCAGCGCCGGG - Intronic
1144647655 17:16986608-16986630 GACCCAAGGCAGCCAGCCCCTGG - Intergenic
1151200676 17:72465657-72465679 TTCCCAAGGGAGCCAGTGCCTGG - Intergenic
1151743763 17:76000936-76000958 TGCCCAGCCCAGCCAGTCCCAGG - Exonic
1151936578 17:77265616-77265638 TGCTCAAGCCATCCAGTCCCCGG - Intergenic
1152257233 17:79247251-79247273 TACCGAAGCCAGCCAGGGTGGGG - Intronic
1152671783 17:81612404-81612426 CATGCAAGCAAGCCAGTGCCAGG + Intronic
1155234856 18:23809075-23809097 TACCCAAGTCCCCCAGTGCTTGG - Intronic
1156373386 18:36491009-36491031 TACCCCAGCCAGACACTGCCAGG + Intronic
1157488208 18:48104584-48104606 CATCCATCCCAGCCAGTGCCTGG + Intronic
1157602489 18:48902484-48902506 TAACAGAGCCAGCCAGTCCCTGG + Intergenic
1158019717 18:52827124-52827146 TAGCAAACCCAGCCAGGGCCTGG + Intronic
1162808243 19:13150078-13150100 TACCCAAGCCAGCCAGTGCCCGG - Intronic
1163321216 19:16576146-16576168 AATCCAGGCCAGCCAGTGGCCGG - Exonic
1163444066 19:17336672-17336694 GACCCCGCCCAGCCAGTGCCTGG + Intronic
1163639964 19:18456587-18456609 TGCCCAAGCCACACACTGCCTGG - Intronic
1164231340 19:23290692-23290714 TGCCTCAGCCTGCCAGTGCCTGG - Intergenic
1164669855 19:30066383-30066405 TCCCCAAGCCAGGCTGAGCCTGG + Intergenic
1168075856 19:53980697-53980719 GACCAAAGCCAGTCAGTACCTGG + Intronic
925128865 2:1480601-1480623 CACACGAGCCAGCCAGGGCCAGG + Intronic
925358103 2:3256843-3256865 TGCCCAAGCCCGCCCGTGTCCGG - Intronic
925922491 2:8646948-8646970 TACACAGGCCATCCAGGGCCGGG + Intergenic
926192851 2:10741555-10741577 ACCCCAGGCCCGCCAGTGCCCGG - Intronic
926200499 2:10792877-10792899 TGCCAAAGCCAGTCAGTCCCAGG - Intronic
926740299 2:16105042-16105064 TACCCAGCCCAGCCTGAGCCAGG + Intergenic
926785947 2:16518681-16518703 TACCCAAGGCAAAAAGTGCCAGG + Intergenic
927519696 2:23691282-23691304 CACCCAAGGCAGGCAGGGCCGGG + Intronic
928367991 2:30717459-30717481 TACCCAAGCCAGACACTACAGGG - Intergenic
929240330 2:39647233-39647255 TACCCTAACCACCCAGGGCCAGG - Intergenic
931226527 2:60336615-60336637 TACCCAAAACAGACAGTGCAAGG + Intergenic
931634977 2:64332793-64332815 TGCTCAAGGCAGTCAGTGCCTGG - Intergenic
931804406 2:65790241-65790263 GACCCAACCCAGCCAAGGCCAGG - Intergenic
932840321 2:75076203-75076225 CTCCCATGCCAGTCAGTGCCTGG + Intronic
933449230 2:82425152-82425174 TACCCTAGCCAGGTAGTGACAGG + Intergenic
933654255 2:84874745-84874767 TTGCCAAGCCAACCAGTGACTGG + Intronic
936049860 2:109214494-109214516 AGCCCAAGCCAGCCAGGCCCTGG + Intronic
937225900 2:120368545-120368567 AACCCATGCCAGGCAGTGGCTGG + Intergenic
939908398 2:147948395-147948417 TCACCAAGCCAGCAAATGCCTGG - Intronic
945471692 2:210234445-210234467 TACCCAAGCCAAGGAGTGCCTGG + Intergenic
946024534 2:216664104-216664126 GACCGCAGCCAGCCGGTGCCTGG + Exonic
948513913 2:238490991-238491013 TACACAAGCCAGCTGGTGGCTGG + Intergenic
1170548151 20:17452632-17452654 TAACCAAGCCACCCTGGGCCAGG + Intronic
1171424422 20:25040757-25040779 TACCCAAACCACCCAGCCCCAGG + Intronic
1173479323 20:43386703-43386725 TACCCAAGACAGCAAGTTCATGG + Intergenic
1173522824 20:43712042-43712064 CAGCCAGGCCAGGCAGTGCCTGG + Intronic
1173993419 20:47320036-47320058 AACCCAAGCCAGGCAGGGGCTGG - Intronic
1174601667 20:51729913-51729935 TGCCCCAGCCAGACAGTGCGGGG + Exonic
1175819252 20:61899826-61899848 TGCCCAGCTCAGCCAGTGCCTGG + Intronic
1176418015 21:6490698-6490720 TCCCCAGGCCACCCAGTGCAGGG + Intergenic
1178355271 21:31906050-31906072 TATCAAAGCAAGCCAGTGCATGG - Intronic
1179419123 21:41222010-41222032 TAACCAACTCAGCCACTGCCTGG - Intronic
1179589353 21:42396068-42396090 TACCCGAGCCGTCCGGTGCCCGG + Exonic
1179693509 21:43099028-43099050 TCCCCAGGCCACCCAGTGCAGGG + Intronic
1181151076 22:20883940-20883962 TACCTGAGCCAGAAAGTGCCTGG + Intronic
1181473719 22:23156201-23156223 CGCCAAAGTCAGCCAGTGCCTGG - Intronic
1182136081 22:27904455-27904477 TACCCACTCCTCCCAGTGCCTGG - Intronic
1182739708 22:32558787-32558809 TAGCCAAGGCAGACTGTGCCAGG + Intronic
1183770611 22:39922497-39922519 TACCCAGGTCAGCCAAGGCCAGG + Intronic
1184001943 22:41681263-41681285 TATCAAAGCCATCCAGTGGCAGG + Intronic
1184927256 22:47651519-47651541 TAGCCAGGCCAGCCAGTTCTTGG - Intergenic
1185066553 22:48635204-48635226 GTCCCAAGCCAGCCAGGGCTGGG + Intronic
1185316029 22:50179472-50179494 TCCCCACCCCAGCCAGTGCCTGG - Exonic
951867626 3:27325428-27325450 GACCCAAGCCACTCATTGCCTGG + Intronic
951933262 3:27993703-27993725 TACCTATTTCAGCCAGTGCCAGG - Intergenic
953830669 3:46295167-46295189 TACCCGAGCCAGACACTCCCCGG + Intergenic
954540268 3:51389055-51389077 CCCCCAAGGCAGCCAGTGCACGG + Exonic
956167879 3:66409979-66410001 TTCCCAAACCAGCCAGGCCCAGG - Intronic
956659773 3:71585314-71585336 TACACCAGCCAGCCAGTAGCTGG - Intergenic
961739821 3:129026255-129026277 CACCCCAGGCAGCCTGTGCCAGG + Intronic
962282850 3:134065340-134065362 TCCACAAGCCATCCAGAGCCAGG - Intronic
964315091 3:155434953-155434975 TTCCCAAGCCAGCCTGTGGAAGG - Intronic
967018643 3:185503540-185503562 TTCCCAATCCAGCATGTGCCTGG - Intergenic
967189834 3:186975711-186975733 TACCCATGAAAGGCAGTGCCAGG + Intronic
967777673 3:193401142-193401164 TTCCAAAGCCAGCCTGGGCCAGG + Intergenic
967808391 3:193734860-193734882 CCCGGAAGCCAGCCAGTGCCAGG + Intergenic
967844581 3:194033605-194033627 TCTCAAAGCCAGCCAATGCCTGG - Intergenic
969694431 4:8726548-8726570 TGCCCCAGCCAGCCTGAGCCTGG - Intergenic
978703595 4:111678258-111678280 TAACCAAGCCTGACAGTGCTAGG + Intergenic
984757535 4:183337994-183338016 GAGGCAAGCCAGCCAGTGCCCGG - Intergenic
985517488 5:354406-354428 TGCCCACGCCAGGCCGTGCCCGG + Intronic
985968791 5:3358359-3358381 GAACCAAAACAGCCAGTGCCAGG - Intergenic
986653575 5:9988891-9988913 TTCCCAAGCCAGGAAGTGCTGGG - Intergenic
994401480 5:99285709-99285731 TAGCCAAGTCAGCAAGTACCTGG + Intergenic
996506932 5:124277921-124277943 TACCCATCACAGCCTGTGCCAGG - Intergenic
997110318 5:131067169-131067191 TTTCCAAGCCAGCCTGTGTCTGG - Intergenic
998173040 5:139883440-139883462 CACCCAAGCCTTCCTGTGCCAGG - Intronic
1000930859 5:167249542-167249564 TACCCAGTACAGTCAGTGCCTGG - Intergenic
1001247606 5:170116653-170116675 TACCTAAACCAGCCAGGGCCTGG - Intergenic
1001590438 5:172860958-172860980 GACCCCAGGCAGTCAGTGCCAGG - Intronic
1001835299 5:174826296-174826318 GTCCCAAGCCAGGGAGTGCCTGG + Intergenic
1002705182 5:181155890-181155912 AACCCAGGGCATCCAGTGCCTGG + Exonic
1005535326 6:26749531-26749553 CCCCCAAGCCAGGCAGTTCCGGG - Intergenic
1006079705 6:31558283-31558305 AACCCAAGCCAACCAGGGCCGGG + Exonic
1006152548 6:31997075-31997097 TACCCACCCCCGCCAGAGCCCGG - Intronic
1006158854 6:32029812-32029834 TACCCACCCCCGCCAGAGCCCGG - Intronic
1009006362 6:57793164-57793186 CCCCCAAGCCAGGCAGTTCCGGG - Intergenic
1009906214 6:69872793-69872815 TACTCAAGACTGCCAGTGCTGGG + Intronic
1010222032 6:73456409-73456431 TTCCCAAGCCAGCCAATTTCAGG + Intergenic
1014023514 6:116617728-116617750 TTCCCAACCCAGGCAGTGCTAGG + Intronic
1014500328 6:122180849-122180871 TAACAATGCCAGCCATTGCCAGG + Intergenic
1017751075 6:157491045-157491067 TGCCCATGCCAGCCAGTGACAGG - Intronic
1019774279 7:2903189-2903211 GCCCCCAGCCAGCCACTGCCTGG + Intergenic
1020687718 7:11316239-11316261 TCCCATAGCCAGCCAGTGACTGG + Intergenic
1021971291 7:25968084-25968106 TCCCAAACCCAGCCAGTCCCAGG - Intergenic
1022027838 7:26465380-26465402 TTCTCATGCCAGCCACTGCCTGG - Intergenic
1022603556 7:31785373-31785395 TAGTGAAGCCAGCCATTGCCAGG + Intronic
1024879960 7:54073997-54074019 TGTGCAAACCAGCCAGTGCCGGG - Intergenic
1026148715 7:67770536-67770558 TACCCTACCCAGCCTCTGCCTGG - Intergenic
1029589694 7:101499152-101499174 TCCCCAGGTCAGCCAGTGCCAGG - Intronic
1030142228 7:106316845-106316867 TAGCTATGCCAGCCAGTGCTAGG - Intergenic
1032238733 7:130145066-130145088 TAACCAAGCAAGCCACTGACAGG + Intergenic
1032940267 7:136780586-136780608 TTCCCAAGTGAGGCAGTGCCTGG + Intergenic
1034900114 7:154903117-154903139 TAACAAAGCCAGTCAGTGCTCGG + Intergenic
1038168626 8:25108300-25108322 TACCCCAGCCAGCCTCTTCCTGG + Intergenic
1039896016 8:41717013-41717035 TACACATGGCAGCCAGAGCCGGG - Exonic
1040808070 8:51417459-51417481 TCCCCAAGTCACCCAGAGCCAGG - Intronic
1041254955 8:55972055-55972077 TACCAAATCCAGCCCGTGCCAGG + Intronic
1041324780 8:56652675-56652697 TCCACAAGCCAGGGAGTGCCAGG + Intergenic
1041808929 8:61886725-61886747 CACCCAATACATCCAGTGCCAGG - Intergenic
1042004277 8:64164349-64164371 TAGCCAAGTCTGCCAGTCCCAGG - Intergenic
1042912695 8:73844260-73844282 TGCCTCAGCCTGCCAGTGCCTGG + Intronic
1045425330 8:102060438-102060460 TACCTCGCCCAGCCAGTGCCTGG - Intronic
1047220167 8:122912316-122912338 TGCCCAGGCCAGCCTGTGGCTGG - Intronic
1047774391 8:128057558-128057580 CTCCCACGTCAGCCAGTGCCAGG - Intergenic
1048431395 8:134374850-134374872 TAGCAAATCCAGGCAGTGCCAGG + Intergenic
1049588966 8:143446954-143446976 TCCCCAAGCCAGCCTGGCCCTGG + Intronic
1058677175 9:107410204-107410226 TACCCCAGCCAGCCTCTCCCTGG - Intergenic
1059450301 9:114367548-114367570 TTCTCAGGCCAGCCAGTTCCTGG - Exonic
1060482802 9:124027528-124027550 CACCACACCCAGCCAGTGCCAGG - Intronic
1062409241 9:136414080-136414102 CCCCCAAGCCAGCCAAGGCCGGG + Intronic
1190049640 X:47140242-47140264 TACCCCAGCCACCAAGTACCTGG - Intergenic
1191108136 X:56784902-56784924 TACCCATGCCGCTCAGTGCCTGG + Intergenic
1196008696 X:110863407-110863429 TAGCCAAGTGAGCCAGTGCTGGG + Intergenic
1196186009 X:112745673-112745695 TACCTCAGCCATGCAGTGCCTGG + Intergenic