ID: 1162808274

View in Genome Browser
Species Human (GRCh38)
Location 19:13150202-13150224
Sequence CCGCGAACCCAGGCCGGGAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162808274_1162808283 -1 Left 1162808274 19:13150202-13150224 CCCCTCCCGGCCTGGGTTCGCGG 0: 1
1: 0
2: 2
3: 11
4: 146
Right 1162808283 19:13150224-13150246 GGCTGGTTCCCTCCCAACCGAGG 0: 1
1: 0
2: 0
3: 4
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162808274 Original CRISPR CCGCGAACCCAGGCCGGGAG GGG (reversed) Exonic
900199993 1:1400169-1400191 CCGTGAACCCAGGACGGGCAGGG - Exonic
901238042 1:7678100-7678122 CCGCGGAAACAGGCCTGGAGGGG - Intronic
901309108 1:8255291-8255313 CAGGGAACCCTGGCCGGGCGAGG - Intergenic
902518748 1:17004170-17004192 CAGAGATCCCAGGCCTGGAGGGG + Intronic
903420862 1:23217221-23217243 CGGGGAACTGAGGCCGGGAGCGG - Intergenic
905326583 1:37156763-37156785 CCAGGAACCCAGGCCTAGAGAGG + Intergenic
905653546 1:39671981-39672003 CCGCGAGCCCGGGCCAGGAGCGG - Exonic
906078395 1:43068378-43068400 AAGCGCACCCGGGCCGGGAGGGG + Intergenic
910606592 1:89092075-89092097 CCATGGACCCAGGCCGGGTGCGG - Intergenic
912246316 1:107965050-107965072 CGGCGCACCCGGGCCGGGACCGG - Exonic
912793425 1:112675062-112675084 CCGCGATTCGGGGCCGGGAGTGG - Intronic
914477387 1:148035172-148035194 CAGCGAACCTAGGCTGGGTGAGG + Intergenic
916497267 1:165356814-165356836 CCGCGCAGCCAGGCTGGGAAAGG - Intergenic
916641153 1:166729948-166729970 CTGGGGACCCAGGCTGGGAGGGG - Intergenic
922933344 1:229407037-229407059 CCGAGAGACCAGGGCGGGAGGGG - Intergenic
1066094163 10:32056536-32056558 CTGCGACCCCGGGCCAGGAGTGG - Intergenic
1068544121 10:58327211-58327233 TGGCGAACCGAGGCTGGGAGGGG + Intergenic
1071525135 10:86354070-86354092 CCACGGCCCCAGGCCAGGAGCGG + Intronic
1071577978 10:86743812-86743834 CCGCTAACCCGGCCTGGGAGTGG + Intergenic
1072137486 10:92560941-92560963 AGGCGAACTCAGGCCGGGTGTGG + Intronic
1073124448 10:101140818-101140840 CCAGGAACCCAGGCAGGGATGGG + Intergenic
1077366606 11:2163760-2163782 CGGGGAAACCAGGCCCGGAGGGG + Intergenic
1081492485 11:43579211-43579233 CTGCGAGCGCCGGCCGGGAGGGG - Intronic
1083465188 11:62840892-62840914 ACGCGAAACCAGGCCGGGCGCGG + Intronic
1083677207 11:64332725-64332747 ATTCGAACCCAGGCCGGGAGTGG + Intergenic
1091281356 11:134383555-134383577 CCGGGAAGCCGGGCTGGGAGCGG - Intronic
1091749690 12:3014691-3014713 CCACTAACCGGGGCCGGGAGGGG - Intronic
1095372921 12:41491230-41491252 CCATGAATCCTGGCCGGGAGTGG + Intronic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096668229 12:53181029-53181051 CCGCGTCCCCGGCCCGGGAGAGG + Intronic
1101718551 12:107331899-107331921 CAGCGGACCCAGGTGGGGAGAGG - Intronic
1106645474 13:31629577-31629599 CTGCCACCCCAGGCCGCGAGGGG + Intergenic
1107964832 13:45588999-45589021 CAGCCACCCCAGGCCTGGAGCGG - Intronic
1108126735 13:47252670-47252692 CCAGGAGCCCAGGCTGGGAGAGG - Intergenic
1121279283 14:92687733-92687755 CTGGGAAGCCAGGCAGGGAGGGG + Intronic
1122077619 14:99246152-99246174 CCTCGGACCCAGGCCGAGTGGGG + Intronic
1122787208 14:104169240-104169262 CCCCGATCCCAGGCTGGGCGGGG - Intronic
1122791200 14:104184895-104184917 CCGGGGTCCCGGGCCGGGAGGGG + Intergenic
1122854897 14:104555266-104555288 CAGGGAGCCCAGGCTGGGAGGGG + Intronic
1122982192 14:105196868-105196890 TCGGGACCGCAGGCCGGGAGTGG + Intergenic
1124338885 15:28877023-28877045 CCCCCAACCCAGGCCTGGAGAGG - Intergenic
1125605188 15:40936265-40936287 CCGTGAATCCAGGACGGCAGCGG - Exonic
1129265525 15:74391345-74391367 CCTCGAGGCCAGGCCTGGAGAGG + Intergenic
1130546229 15:84859002-84859024 CCTTGACCCCAGGCTGGGAGGGG - Intronic
1130701786 15:86191051-86191073 CTGAGAACACAGGCCGGGTGTGG + Intronic
1132163674 15:99565443-99565465 CCGGGAGCCCAGGCCGGGAGCGG - Intronic
1132778491 16:1610426-1610448 CCGCGATTCGAGGCCGGGCGGGG + Intronic
1133174762 16:4005914-4005936 CAGCGGACCCGGGCAGGGAGGGG - Intronic
1133924674 16:10182941-10182963 CCGCGGTCCCCGGCCGAGAGAGG + Intergenic
1134069920 16:11254740-11254762 CCTCCAACCCAGGCCGGGGAGGG + Exonic
1136414725 16:30096173-30096195 CTGCGAACCCGGGCCCGGGGGGG - Exonic
1141202537 16:81908915-81908937 CCCCGATCCCAGCCCTGGAGTGG + Intronic
1141830761 16:86508943-86508965 CCGCGTGCGCAGGGCGGGAGGGG - Intergenic
1142188557 16:88706426-88706448 CCGCGAAGCCCGGCTGGGGGCGG - Intergenic
1142737153 17:1908265-1908287 CCGCGACCTCAGCCGGGGAGGGG + Intergenic
1143099729 17:4498664-4498686 CCGCGAACGCCCGCGGGGAGCGG - Intergenic
1143632179 17:8145788-8145810 CCGAGAAGCCTGGCAGGGAGGGG + Intronic
1146283548 17:31559848-31559870 CCGCGACCCGAGGTCGGGCGGGG + Intergenic
1146944260 17:36863319-36863341 CCGGGAACCTGGGCCCGGAGGGG + Intergenic
1148157204 17:45431220-45431242 CCCCGAAGCCCGGGCGGGAGCGG - Intronic
1150130042 17:62664247-62664269 AAGCAAACCCAGGCCGGGCGCGG - Intronic
1150983473 17:70169403-70169425 CCGGGAACCGCGGCGGGGAGGGG - Intronic
1152017759 17:77762961-77762983 CCAAGAACCCATGCCGGGAGGGG + Intergenic
1152017943 17:77764242-77764264 CCAAGAACCCATGCCTGGAGAGG + Intergenic
1152353668 17:79796865-79796887 GAGGGAACCCGGGCCGGGAGGGG + Intronic
1152870881 17:82752406-82752428 CGCCGAACCCGGGCCGGGGGAGG - Intronic
1153185476 18:2481469-2481491 CCAAGAACCAGGGCCGGGAGTGG + Intergenic
1157621425 18:49019244-49019266 CCCAGAGCCCAGGCCTGGAGGGG - Intergenic
1160705679 19:529080-529102 TCCCCAACCCAGGCCGGGCGCGG + Intergenic
1161073179 19:2272449-2272471 AAGGGACCCCAGGCCGGGAGCGG - Intronic
1161337909 19:3724155-3724177 CCCCGAACCCAGAGTGGGAGAGG - Intronic
1162808274 19:13150202-13150224 CCGCGAACCCAGGCCGGGAGGGG - Exonic
1163102647 19:15107558-15107580 CCCCGCTCCCAGGCCGGGTGGGG - Intronic
1163493070 19:17628169-17628191 CCACGACCCCAGGCCTGGTGGGG + Intronic
1165331990 19:35145168-35145190 CCGCCACCCCAGGCTGGGTGGGG - Intronic
1165345943 19:35248941-35248963 GCGCGCACCAAGGCCAGGAGGGG - Exonic
1168359353 19:55725734-55725756 CAGGGAACCCAGGCCGGGCGCGG + Intronic
926018582 2:9474980-9475002 CCGCTAACCCGGACCCGGAGGGG - Intronic
926437676 2:12854323-12854345 CCGCCAGCCCAGGCAGTGAGGGG - Intergenic
928172429 2:29012197-29012219 CCCCGAACCCAGGCCAGGGTGGG + Intronic
928637039 2:33257477-33257499 CCGGGAACACGGGCCAGGAGTGG + Exonic
928904626 2:36356246-36356268 CCTCGCAGCCGGGCCGGGAGCGG - Exonic
929918236 2:46154073-46154095 CTGCATACCCAGGCCGGGCGTGG - Intronic
933923903 2:87075676-87075698 CCCGGAAACCCGGCCGGGAGCGG - Intergenic
937361256 2:121231592-121231614 CCGGGCACCCAGCCCAGGAGGGG + Intronic
938368838 2:130756262-130756284 CCGCGCGCCGCGGCCGGGAGGGG - Intronic
938397766 2:130963640-130963662 GCGCGCACGCAGGCCTGGAGCGG - Intronic
942653577 2:178193730-178193752 CACCGAACGCAGGCCGGGAGTGG + Intergenic
944472288 2:200066797-200066819 CTGCAAACCCAGGCTGGGAAGGG - Intergenic
946239346 2:218344503-218344525 CCGAGAACCTGGCCCGGGAGAGG + Exonic
946442331 2:219707055-219707077 CCACTAACCCAGTCAGGGAGAGG + Intergenic
947593209 2:231396342-231396364 CCGCCCACCGAGGCCGGGACGGG - Intronic
948421764 2:237864352-237864374 CCCTGGCCCCAGGCCGGGAGGGG + Intronic
948537605 2:238657857-238657879 CAGCCCACACAGGCCGGGAGAGG + Intergenic
948610628 2:239164066-239164088 CAAAGAACCAAGGCCGGGAGGGG + Intronic
948934079 2:241150782-241150804 GCGCGAGGCCAGGCCGGGGGTGG + Intronic
949031735 2:241800331-241800353 CCGCCGACCCAGGCTGGGAGCGG + Intronic
1172779115 20:37425249-37425271 CCTCGTACCCAGGCCAGGGGTGG + Intergenic
1172892513 20:38277021-38277043 CTGCAAACACAGGCCGGGTGCGG + Intronic
1175374676 20:58515805-58515827 CCACGAACCCAGAGAGGGAGAGG + Intergenic
1176242066 20:64079812-64079834 CCCCGGGCCCGGGCCGGGAGGGG + Intronic
1179928250 21:44550316-44550338 CTCCGCACCCAGGGCGGGAGGGG - Intronic
1179939435 21:44628397-44628419 CTCCGCACCCAGGGCGGGAGGGG + Intronic
1180615045 22:17121169-17121191 CCGCCAACCCCGGGCGGGCGAGG + Exonic
949598928 3:5577797-5577819 CCACTAACCCCGGCCGGGCGCGG - Intergenic
950522544 3:13505492-13505514 CCGCTGACCCAGGTGGGGAGAGG + Exonic
950576982 3:13837895-13837917 ACGCCAACACAGGTCGGGAGAGG - Intronic
954072401 3:48152363-48152385 CCAGGAAGCCAGGCAGGGAGGGG - Intergenic
956414650 3:69013464-69013486 CCGGGAAGCCGCGCCGGGAGCGG + Intronic
958726393 3:97910590-97910612 GCGCGAACCGAAGCAGGGAGAGG - Intronic
960045091 3:113189518-113189540 CATCGAACCTAGGCAGGGAGAGG - Intergenic
963612611 3:147490569-147490591 TGGAGAACCCAGGCAGGGAGAGG - Intronic
968636290 4:1682029-1682051 CAAGGAACCCAGGCCTGGAGAGG - Intronic
968950232 4:3687699-3687721 CCGCGAAGCCAGGCCGGGTGCGG + Intergenic
974061909 4:57043052-57043074 CCGGGAAGCCAGGCCGTCAGGGG - Intronic
978778201 4:112523177-112523199 CCGGGTCTCCAGGCCGGGAGGGG + Intergenic
982025203 4:151245890-151245912 TCATAAACCCAGGCCGGGAGTGG - Intronic
984278458 4:177638394-177638416 CAGGGAACCCATGCCGGGAGTGG - Intergenic
991085920 5:62648348-62648370 CAGTGCACCCTGGCCGGGAGGGG + Intergenic
992365491 5:76084866-76084888 CCGCCAGCCCAGGCCGTGCGGGG - Intronic
996753715 5:126914932-126914954 GCGCAAACCCAGGCCGTTAGTGG - Exonic
1001481330 5:172091143-172091165 CATGGAACACAGGCCGGGAGTGG - Intronic
1001820970 5:174710028-174710050 CCACTCACCCAGACCGGGAGTGG + Intergenic
1002193944 5:177492296-177492318 CCCCAATCCCTGGCCGGGAGTGG - Intronic
1007115442 6:39339967-39339989 TCGAGAGCCCAGGCAGGGAGAGG + Intronic
1007777490 6:44231912-44231934 CCACGAATCCAGGCCAGGCGTGG - Intronic
1007805497 6:44441868-44441890 CCCCTTATCCAGGCCGGGAGTGG + Intronic
1016992805 6:149941691-149941713 TCGCGGACCCAGGCGGGGACAGG + Intergenic
1019796184 7:3050382-3050404 TTGGGAACCCAGGCAGGGAGAGG - Intergenic
1021054226 7:16027108-16027130 TCAAGAACCTAGGCCGGGAGTGG + Intergenic
1021600291 7:22357257-22357279 CCGCGCACCTGGGCGGGGAGGGG - Intergenic
1022020874 7:26398541-26398563 CCGCCGAGCCGGGCCGGGAGGGG - Intergenic
1022106444 7:27200450-27200472 CCGCGCAACCAGGCGGGGAGGGG + Intergenic
1026237002 7:68535351-68535373 CCGCCAGCCCTGGCAGGGAGGGG - Intergenic
1029280123 7:99430057-99430079 CCAGGACCCCAGGCCTGGAGTGG - Intronic
1030215954 7:107044478-107044500 CTGCGCGCCCGGGCCGGGAGAGG - Intergenic
1034129162 7:148699366-148699388 CCGAGAACCCAGCCCGGTCGCGG - Intronic
1034188184 7:149195363-149195385 TGGCGACCCCAGTCCGGGAGTGG + Intergenic
1037802054 8:22041217-22041239 TCGGGAACCCAGCCCAGGAGTGG - Intergenic
1037818574 8:22124810-22124832 CTGGGAACCCAGGCTGGGAGTGG + Intronic
1037859045 8:22391856-22391878 CAGGGAGCCCTGGCCGGGAGCGG - Intronic
1042141302 8:65681200-65681222 GCTTGAACCCAGGCCGGGCGCGG - Intronic
1045098967 8:98825950-98825972 CCGCCAACCCAGGCCGCGGCAGG - Intronic
1046814096 8:118565046-118565068 CCAAGAACCCAGGAGGGGAGGGG + Intronic
1048971412 8:139647054-139647076 CCGCCAACAGAGGGCGGGAGAGG - Intronic
1049791689 8:144475289-144475311 CCGTGAGCCCAGACGGGGAGGGG + Intronic
1049988375 9:972005-972027 CCGCGAGGCCGGGCTGGGAGGGG + Intergenic
1051171538 9:14322595-14322617 CCGCGCGCCCAGGCCGGCCGTGG - Intronic
1051621018 9:19049497-19049519 GCGCGAACCCGGGGCTGGAGAGG - Exonic
1057488607 9:95506027-95506049 CCGCGGAGCGGGGCCGGGAGAGG + Intronic
1060406119 9:123373885-123373907 CCCCGAAGCCAGGCGGGCAGCGG - Exonic
1060823646 9:126675190-126675212 ACCCAAAACCAGGCCGGGAGGGG + Intronic
1061851256 9:133417305-133417327 TCCCGAAACCAGGCCGGGCGCGG - Intronic
1062076446 9:134592594-134592616 CCTGGAGGCCAGGCCGGGAGGGG - Intergenic
1185610806 X:1392749-1392771 CCACCAACCTAGGCCGGGCGCGG - Intergenic
1187566156 X:20451577-20451599 ACGTGAAACCAGGCCGGGTGCGG - Intergenic
1189932804 X:46033069-46033091 CCTCGAAACAAGGCCGGGCGCGG + Intergenic
1193425630 X:81337898-81337920 CCGAGAGCCCAGGCAGGGTGTGG + Intergenic
1197236829 X:124075562-124075584 CCACTATCCCAGGCCGGGTGTGG - Intronic
1201707097 Y:16949628-16949650 CCGCAAACCCAGGCCCCTAGAGG - Intergenic