ID: 1162809528

View in Genome Browser
Species Human (GRCh38)
Location 19:13155657-13155679
Sequence GGGCGGGGCGAGCGCTTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162809528_1162809541 22 Left 1162809528 19:13155657-13155679 CCGGGAAAGCGCTCGCCCCGCCC No data
Right 1162809541 19:13155702-13155724 CGCAGGCTTCCCATGACCCCAGG No data
1162809528_1162809538 5 Left 1162809528 19:13155657-13155679 CCGGGAAAGCGCTCGCCCCGCCC No data
Right 1162809538 19:13155685-13155707 ACGGCTGGCTCTGCCGCCGCAGG No data
1162809528_1162809542 23 Left 1162809528 19:13155657-13155679 CCGGGAAAGCGCTCGCCCCGCCC No data
Right 1162809542 19:13155703-13155725 GCAGGCTTCCCATGACCCCAGGG No data
1162809528_1162809543 24 Left 1162809528 19:13155657-13155679 CCGGGAAAGCGCTCGCCCCGCCC No data
Right 1162809543 19:13155704-13155726 CAGGCTTCCCATGACCCCAGGGG No data
1162809528_1162809530 -10 Left 1162809528 19:13155657-13155679 CCGGGAAAGCGCTCGCCCCGCCC No data
Right 1162809530 19:13155670-13155692 CGCCCCGCCCCGCCGACGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162809528 Original CRISPR GGGCGGGGCGAGCGCTTTCC CGG (reversed) Intergenic
No off target data available for this crispr