ID: 1162809530

View in Genome Browser
Species Human (GRCh38)
Location 19:13155670-13155692
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162809528_1162809530 -10 Left 1162809528 19:13155657-13155679 CCGGGAAAGCGCTCGCCCCGCCC No data
Right 1162809530 19:13155670-13155692 CGCCCCGCCCCGCCGACGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162809530 Original CRISPR CGCCCCGCCCCGCCGACGGC TGG Intergenic
No off target data available for this crispr