ID: 1162809537

View in Genome Browser
Species Human (GRCh38)
Location 19:13155682-13155704
Sequence GCGGCGGCAGAGCCAGCCGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162809537_1162809551 21 Left 1162809537 19:13155682-13155704 CCGACGGCTGGCTCTGCCGCCGC No data
Right 1162809551 19:13155726-13155748 GAACTGACCCCGTGGCCACAGGG No data
1162809537_1162809543 -1 Left 1162809537 19:13155682-13155704 CCGACGGCTGGCTCTGCCGCCGC No data
Right 1162809543 19:13155704-13155726 CAGGCTTCCCATGACCCCAGGGG No data
1162809537_1162809541 -3 Left 1162809537 19:13155682-13155704 CCGACGGCTGGCTCTGCCGCCGC No data
Right 1162809541 19:13155702-13155724 CGCAGGCTTCCCATGACCCCAGG No data
1162809537_1162809542 -2 Left 1162809537 19:13155682-13155704 CCGACGGCTGGCTCTGCCGCCGC No data
Right 1162809542 19:13155703-13155725 GCAGGCTTCCCATGACCCCAGGG No data
1162809537_1162809553 28 Left 1162809537 19:13155682-13155704 CCGACGGCTGGCTCTGCCGCCGC No data
Right 1162809553 19:13155733-13155755 CCCCGTGGCCACAGGGTAGAAGG No data
1162809537_1162809547 13 Left 1162809537 19:13155682-13155704 CCGACGGCTGGCTCTGCCGCCGC No data
Right 1162809547 19:13155718-13155740 CCCCAGGGGAACTGACCCCGTGG No data
1162809537_1162809550 20 Left 1162809537 19:13155682-13155704 CCGACGGCTGGCTCTGCCGCCGC No data
Right 1162809550 19:13155725-13155747 GGAACTGACCCCGTGGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162809537 Original CRISPR GCGGCGGCAGAGCCAGCCGT CGG (reversed) Intergenic
No off target data available for this crispr