ID: 1162809538

View in Genome Browser
Species Human (GRCh38)
Location 19:13155685-13155707
Sequence ACGGCTGGCTCTGCCGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162809531_1162809538 -10 Left 1162809531 19:13155672-13155694 CCCCGCCCCGCCGACGGCTGGCT No data
Right 1162809538 19:13155685-13155707 ACGGCTGGCTCTGCCGCCGCAGG No data
1162809528_1162809538 5 Left 1162809528 19:13155657-13155679 CCGGGAAAGCGCTCGCCCCGCCC No data
Right 1162809538 19:13155685-13155707 ACGGCTGGCTCTGCCGCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162809538 Original CRISPR ACGGCTGGCTCTGCCGCCGC AGG Intergenic
No off target data available for this crispr