ID: 1162809539

View in Genome Browser
Species Human (GRCh38)
Location 19:13155698-13155720
Sequence GGGTCATGGGAAGCCTGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162809539_1162809550 4 Left 1162809539 19:13155698-13155720 CCGCCGCAGGCTTCCCATGACCC No data
Right 1162809550 19:13155725-13155747 GGAACTGACCCCGTGGCCACAGG No data
1162809539_1162809560 25 Left 1162809539 19:13155698-13155720 CCGCCGCAGGCTTCCCATGACCC No data
Right 1162809560 19:13155746-13155768 GGGTAGAAGGAGGGGCAAGCCGG No data
1162809539_1162809547 -3 Left 1162809539 19:13155698-13155720 CCGCCGCAGGCTTCCCATGACCC No data
Right 1162809547 19:13155718-13155740 CCCCAGGGGAACTGACCCCGTGG No data
1162809539_1162809556 15 Left 1162809539 19:13155698-13155720 CCGCCGCAGGCTTCCCATGACCC No data
Right 1162809556 19:13155736-13155758 CGTGGCCACAGGGTAGAAGGAGG No data
1162809539_1162809551 5 Left 1162809539 19:13155698-13155720 CCGCCGCAGGCTTCCCATGACCC No data
Right 1162809551 19:13155726-13155748 GAACTGACCCCGTGGCCACAGGG No data
1162809539_1162809558 17 Left 1162809539 19:13155698-13155720 CCGCCGCAGGCTTCCCATGACCC No data
Right 1162809558 19:13155738-13155760 TGGCCACAGGGTAGAAGGAGGGG No data
1162809539_1162809553 12 Left 1162809539 19:13155698-13155720 CCGCCGCAGGCTTCCCATGACCC No data
Right 1162809553 19:13155733-13155755 CCCCGTGGCCACAGGGTAGAAGG No data
1162809539_1162809557 16 Left 1162809539 19:13155698-13155720 CCGCCGCAGGCTTCCCATGACCC No data
Right 1162809557 19:13155737-13155759 GTGGCCACAGGGTAGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162809539 Original CRISPR GGGTCATGGGAAGCCTGCGG CGG (reversed) Intergenic
No off target data available for this crispr