ID: 1162809540

View in Genome Browser
Species Human (GRCh38)
Location 19:13155701-13155723
Sequence CTGGGGTCATGGGAAGCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162809540_1162809550 1 Left 1162809540 19:13155701-13155723 CCGCAGGCTTCCCATGACCCCAG No data
Right 1162809550 19:13155725-13155747 GGAACTGACCCCGTGGCCACAGG No data
1162809540_1162809551 2 Left 1162809540 19:13155701-13155723 CCGCAGGCTTCCCATGACCCCAG No data
Right 1162809551 19:13155726-13155748 GAACTGACCCCGTGGCCACAGGG No data
1162809540_1162809558 14 Left 1162809540 19:13155701-13155723 CCGCAGGCTTCCCATGACCCCAG No data
Right 1162809558 19:13155738-13155760 TGGCCACAGGGTAGAAGGAGGGG No data
1162809540_1162809556 12 Left 1162809540 19:13155701-13155723 CCGCAGGCTTCCCATGACCCCAG No data
Right 1162809556 19:13155736-13155758 CGTGGCCACAGGGTAGAAGGAGG No data
1162809540_1162809553 9 Left 1162809540 19:13155701-13155723 CCGCAGGCTTCCCATGACCCCAG No data
Right 1162809553 19:13155733-13155755 CCCCGTGGCCACAGGGTAGAAGG No data
1162809540_1162809557 13 Left 1162809540 19:13155701-13155723 CCGCAGGCTTCCCATGACCCCAG No data
Right 1162809557 19:13155737-13155759 GTGGCCACAGGGTAGAAGGAGGG No data
1162809540_1162809560 22 Left 1162809540 19:13155701-13155723 CCGCAGGCTTCCCATGACCCCAG No data
Right 1162809560 19:13155746-13155768 GGGTAGAAGGAGGGGCAAGCCGG No data
1162809540_1162809547 -6 Left 1162809540 19:13155701-13155723 CCGCAGGCTTCCCATGACCCCAG No data
Right 1162809547 19:13155718-13155740 CCCCAGGGGAACTGACCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162809540 Original CRISPR CTGGGGTCATGGGAAGCCTG CGG (reversed) Intergenic
No off target data available for this crispr