ID: 1162809541

View in Genome Browser
Species Human (GRCh38)
Location 19:13155702-13155724
Sequence CGCAGGCTTCCCATGACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162809528_1162809541 22 Left 1162809528 19:13155657-13155679 CCGGGAAAGCGCTCGCCCCGCCC No data
Right 1162809541 19:13155702-13155724 CGCAGGCTTCCCATGACCCCAGG No data
1162809534_1162809541 2 Left 1162809534 19:13155677-13155699 CCCCGCCGACGGCTGGCTCTGCC No data
Right 1162809541 19:13155702-13155724 CGCAGGCTTCCCATGACCCCAGG No data
1162809536_1162809541 0 Left 1162809536 19:13155679-13155701 CCGCCGACGGCTGGCTCTGCCGC No data
Right 1162809541 19:13155702-13155724 CGCAGGCTTCCCATGACCCCAGG No data
1162809535_1162809541 1 Left 1162809535 19:13155678-13155700 CCCGCCGACGGCTGGCTCTGCCG No data
Right 1162809541 19:13155702-13155724 CGCAGGCTTCCCATGACCCCAGG No data
1162809537_1162809541 -3 Left 1162809537 19:13155682-13155704 CCGACGGCTGGCTCTGCCGCCGC No data
Right 1162809541 19:13155702-13155724 CGCAGGCTTCCCATGACCCCAGG No data
1162809533_1162809541 5 Left 1162809533 19:13155674-13155696 CCGCCCCGCCGACGGCTGGCTCT No data
Right 1162809541 19:13155702-13155724 CGCAGGCTTCCCATGACCCCAGG No data
1162809531_1162809541 7 Left 1162809531 19:13155672-13155694 CCCCGCCCCGCCGACGGCTGGCT No data
Right 1162809541 19:13155702-13155724 CGCAGGCTTCCCATGACCCCAGG No data
1162809532_1162809541 6 Left 1162809532 19:13155673-13155695 CCCGCCCCGCCGACGGCTGGCTC No data
Right 1162809541 19:13155702-13155724 CGCAGGCTTCCCATGACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162809541 Original CRISPR CGCAGGCTTCCCATGACCCC AGG Intergenic
No off target data available for this crispr