ID: 1162809546

View in Genome Browser
Species Human (GRCh38)
Location 19:13155718-13155740
Sequence CCACGGGGTCAGTTCCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162809546_1162809563 26 Left 1162809546 19:13155718-13155740 CCCCAGGGGAACTGACCCCGTGG No data
Right 1162809563 19:13155767-13155789 GGCCTCAGAACGTCTGCTGGTGG No data
1162809546_1162809556 -5 Left 1162809546 19:13155718-13155740 CCCCAGGGGAACTGACCCCGTGG No data
Right 1162809556 19:13155736-13155758 CGTGGCCACAGGGTAGAAGGAGG No data
1162809546_1162809560 5 Left 1162809546 19:13155718-13155740 CCCCAGGGGAACTGACCCCGTGG No data
Right 1162809560 19:13155746-13155768 GGGTAGAAGGAGGGGCAAGCCGG No data
1162809546_1162809557 -4 Left 1162809546 19:13155718-13155740 CCCCAGGGGAACTGACCCCGTGG No data
Right 1162809557 19:13155737-13155759 GTGGCCACAGGGTAGAAGGAGGG No data
1162809546_1162809558 -3 Left 1162809546 19:13155718-13155740 CCCCAGGGGAACTGACCCCGTGG No data
Right 1162809558 19:13155738-13155760 TGGCCACAGGGTAGAAGGAGGGG No data
1162809546_1162809553 -8 Left 1162809546 19:13155718-13155740 CCCCAGGGGAACTGACCCCGTGG No data
Right 1162809553 19:13155733-13155755 CCCCGTGGCCACAGGGTAGAAGG No data
1162809546_1162809561 23 Left 1162809546 19:13155718-13155740 CCCCAGGGGAACTGACCCCGTGG No data
Right 1162809561 19:13155764-13155786 GCCGGCCTCAGAACGTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162809546 Original CRISPR CCACGGGGTCAGTTCCCCTG GGG (reversed) Intergenic
No off target data available for this crispr