ID: 1162809547

View in Genome Browser
Species Human (GRCh38)
Location 19:13155718-13155740
Sequence CCCCAGGGGAACTGACCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162809534_1162809547 18 Left 1162809534 19:13155677-13155699 CCCCGCCGACGGCTGGCTCTGCC No data
Right 1162809547 19:13155718-13155740 CCCCAGGGGAACTGACCCCGTGG No data
1162809532_1162809547 22 Left 1162809532 19:13155673-13155695 CCCGCCCCGCCGACGGCTGGCTC No data
Right 1162809547 19:13155718-13155740 CCCCAGGGGAACTGACCCCGTGG No data
1162809531_1162809547 23 Left 1162809531 19:13155672-13155694 CCCCGCCCCGCCGACGGCTGGCT No data
Right 1162809547 19:13155718-13155740 CCCCAGGGGAACTGACCCCGTGG No data
1162809533_1162809547 21 Left 1162809533 19:13155674-13155696 CCGCCCCGCCGACGGCTGGCTCT No data
Right 1162809547 19:13155718-13155740 CCCCAGGGGAACTGACCCCGTGG No data
1162809535_1162809547 17 Left 1162809535 19:13155678-13155700 CCCGCCGACGGCTGGCTCTGCCG No data
Right 1162809547 19:13155718-13155740 CCCCAGGGGAACTGACCCCGTGG No data
1162809536_1162809547 16 Left 1162809536 19:13155679-13155701 CCGCCGACGGCTGGCTCTGCCGC No data
Right 1162809547 19:13155718-13155740 CCCCAGGGGAACTGACCCCGTGG No data
1162809540_1162809547 -6 Left 1162809540 19:13155701-13155723 CCGCAGGCTTCCCATGACCCCAG No data
Right 1162809547 19:13155718-13155740 CCCCAGGGGAACTGACCCCGTGG No data
1162809539_1162809547 -3 Left 1162809539 19:13155698-13155720 CCGCCGCAGGCTTCCCATGACCC No data
Right 1162809547 19:13155718-13155740 CCCCAGGGGAACTGACCCCGTGG No data
1162809537_1162809547 13 Left 1162809537 19:13155682-13155704 CCGACGGCTGGCTCTGCCGCCGC No data
Right 1162809547 19:13155718-13155740 CCCCAGGGGAACTGACCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162809547 Original CRISPR CCCCAGGGGAACTGACCCCG TGG Intergenic
No off target data available for this crispr