ID: 1162809551

View in Genome Browser
Species Human (GRCh38)
Location 19:13155726-13155748
Sequence GAACTGACCCCGTGGCCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162809537_1162809551 21 Left 1162809537 19:13155682-13155704 CCGACGGCTGGCTCTGCCGCCGC No data
Right 1162809551 19:13155726-13155748 GAACTGACCCCGTGGCCACAGGG No data
1162809540_1162809551 2 Left 1162809540 19:13155701-13155723 CCGCAGGCTTCCCATGACCCCAG No data
Right 1162809551 19:13155726-13155748 GAACTGACCCCGTGGCCACAGGG No data
1162809536_1162809551 24 Left 1162809536 19:13155679-13155701 CCGCCGACGGCTGGCTCTGCCGC No data
Right 1162809551 19:13155726-13155748 GAACTGACCCCGTGGCCACAGGG No data
1162809533_1162809551 29 Left 1162809533 19:13155674-13155696 CCGCCCCGCCGACGGCTGGCTCT No data
Right 1162809551 19:13155726-13155748 GAACTGACCCCGTGGCCACAGGG No data
1162809534_1162809551 26 Left 1162809534 19:13155677-13155699 CCCCGCCGACGGCTGGCTCTGCC No data
Right 1162809551 19:13155726-13155748 GAACTGACCCCGTGGCCACAGGG No data
1162809544_1162809551 -8 Left 1162809544 19:13155711-13155733 CCCATGACCCCAGGGGAACTGAC No data
Right 1162809551 19:13155726-13155748 GAACTGACCCCGTGGCCACAGGG No data
1162809532_1162809551 30 Left 1162809532 19:13155673-13155695 CCCGCCCCGCCGACGGCTGGCTC No data
Right 1162809551 19:13155726-13155748 GAACTGACCCCGTGGCCACAGGG No data
1162809545_1162809551 -9 Left 1162809545 19:13155712-13155734 CCATGACCCCAGGGGAACTGACC No data
Right 1162809551 19:13155726-13155748 GAACTGACCCCGTGGCCACAGGG No data
1162809535_1162809551 25 Left 1162809535 19:13155678-13155700 CCCGCCGACGGCTGGCTCTGCCG No data
Right 1162809551 19:13155726-13155748 GAACTGACCCCGTGGCCACAGGG No data
1162809539_1162809551 5 Left 1162809539 19:13155698-13155720 CCGCCGCAGGCTTCCCATGACCC No data
Right 1162809551 19:13155726-13155748 GAACTGACCCCGTGGCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162809551 Original CRISPR GAACTGACCCCGTGGCCACA GGG Intergenic
No off target data available for this crispr