ID: 1162809553

View in Genome Browser
Species Human (GRCh38)
Location 19:13155733-13155755
Sequence CCCCGTGGCCACAGGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162809546_1162809553 -8 Left 1162809546 19:13155718-13155740 CCCCAGGGGAACTGACCCCGTGG No data
Right 1162809553 19:13155733-13155755 CCCCGTGGCCACAGGGTAGAAGG No data
1162809539_1162809553 12 Left 1162809539 19:13155698-13155720 CCGCCGCAGGCTTCCCATGACCC No data
Right 1162809553 19:13155733-13155755 CCCCGTGGCCACAGGGTAGAAGG No data
1162809540_1162809553 9 Left 1162809540 19:13155701-13155723 CCGCAGGCTTCCCATGACCCCAG No data
Right 1162809553 19:13155733-13155755 CCCCGTGGCCACAGGGTAGAAGG No data
1162809549_1162809553 -10 Left 1162809549 19:13155720-13155742 CCAGGGGAACTGACCCCGTGGCC No data
Right 1162809553 19:13155733-13155755 CCCCGTGGCCACAGGGTAGAAGG No data
1162809548_1162809553 -9 Left 1162809548 19:13155719-13155741 CCCAGGGGAACTGACCCCGTGGC No data
Right 1162809553 19:13155733-13155755 CCCCGTGGCCACAGGGTAGAAGG No data
1162809545_1162809553 -2 Left 1162809545 19:13155712-13155734 CCATGACCCCAGGGGAACTGACC No data
Right 1162809553 19:13155733-13155755 CCCCGTGGCCACAGGGTAGAAGG No data
1162809544_1162809553 -1 Left 1162809544 19:13155711-13155733 CCCATGACCCCAGGGGAACTGAC No data
Right 1162809553 19:13155733-13155755 CCCCGTGGCCACAGGGTAGAAGG No data
1162809537_1162809553 28 Left 1162809537 19:13155682-13155704 CCGACGGCTGGCTCTGCCGCCGC No data
Right 1162809553 19:13155733-13155755 CCCCGTGGCCACAGGGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162809553 Original CRISPR CCCCGTGGCCACAGGGTAGA AGG Intergenic
No off target data available for this crispr