ID: 1162809556

View in Genome Browser
Species Human (GRCh38)
Location 19:13155736-13155758
Sequence CGTGGCCACAGGGTAGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162809546_1162809556 -5 Left 1162809546 19:13155718-13155740 CCCCAGGGGAACTGACCCCGTGG No data
Right 1162809556 19:13155736-13155758 CGTGGCCACAGGGTAGAAGGAGG No data
1162809545_1162809556 1 Left 1162809545 19:13155712-13155734 CCATGACCCCAGGGGAACTGACC No data
Right 1162809556 19:13155736-13155758 CGTGGCCACAGGGTAGAAGGAGG No data
1162809548_1162809556 -6 Left 1162809548 19:13155719-13155741 CCCAGGGGAACTGACCCCGTGGC No data
Right 1162809556 19:13155736-13155758 CGTGGCCACAGGGTAGAAGGAGG No data
1162809549_1162809556 -7 Left 1162809549 19:13155720-13155742 CCAGGGGAACTGACCCCGTGGCC No data
Right 1162809556 19:13155736-13155758 CGTGGCCACAGGGTAGAAGGAGG No data
1162809540_1162809556 12 Left 1162809540 19:13155701-13155723 CCGCAGGCTTCCCATGACCCCAG No data
Right 1162809556 19:13155736-13155758 CGTGGCCACAGGGTAGAAGGAGG No data
1162809539_1162809556 15 Left 1162809539 19:13155698-13155720 CCGCCGCAGGCTTCCCATGACCC No data
Right 1162809556 19:13155736-13155758 CGTGGCCACAGGGTAGAAGGAGG No data
1162809544_1162809556 2 Left 1162809544 19:13155711-13155733 CCCATGACCCCAGGGGAACTGAC No data
Right 1162809556 19:13155736-13155758 CGTGGCCACAGGGTAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162809556 Original CRISPR CGTGGCCACAGGGTAGAAGG AGG Intergenic
No off target data available for this crispr