ID: 1162809561

View in Genome Browser
Species Human (GRCh38)
Location 19:13155764-13155786
Sequence GCCGGCCTCAGAACGTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162809545_1162809561 29 Left 1162809545 19:13155712-13155734 CCATGACCCCAGGGGAACTGACC No data
Right 1162809561 19:13155764-13155786 GCCGGCCTCAGAACGTCTGCTGG No data
1162809555_1162809561 6 Left 1162809555 19:13155735-13155757 CCGTGGCCACAGGGTAGAAGGAG No data
Right 1162809561 19:13155764-13155786 GCCGGCCTCAGAACGTCTGCTGG No data
1162809548_1162809561 22 Left 1162809548 19:13155719-13155741 CCCAGGGGAACTGACCCCGTGGC No data
Right 1162809561 19:13155764-13155786 GCCGGCCTCAGAACGTCTGCTGG No data
1162809546_1162809561 23 Left 1162809546 19:13155718-13155740 CCCCAGGGGAACTGACCCCGTGG No data
Right 1162809561 19:13155764-13155786 GCCGGCCTCAGAACGTCTGCTGG No data
1162809549_1162809561 21 Left 1162809549 19:13155720-13155742 CCAGGGGAACTGACCCCGTGGCC No data
Right 1162809561 19:13155764-13155786 GCCGGCCTCAGAACGTCTGCTGG No data
1162809544_1162809561 30 Left 1162809544 19:13155711-13155733 CCCATGACCCCAGGGGAACTGAC No data
Right 1162809561 19:13155764-13155786 GCCGGCCTCAGAACGTCTGCTGG No data
1162809559_1162809561 0 Left 1162809559 19:13155741-13155763 CCACAGGGTAGAAGGAGGGGCAA No data
Right 1162809561 19:13155764-13155786 GCCGGCCTCAGAACGTCTGCTGG No data
1162809552_1162809561 8 Left 1162809552 19:13155733-13155755 CCCCGTGGCCACAGGGTAGAAGG No data
Right 1162809561 19:13155764-13155786 GCCGGCCTCAGAACGTCTGCTGG No data
1162809554_1162809561 7 Left 1162809554 19:13155734-13155756 CCCGTGGCCACAGGGTAGAAGGA No data
Right 1162809561 19:13155764-13155786 GCCGGCCTCAGAACGTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162809561 Original CRISPR GCCGGCCTCAGAACGTCTGC TGG Intergenic
No off target data available for this crispr