ID: 1162816509

View in Genome Browser
Species Human (GRCh38)
Location 19:13198651-13198673
Sequence GGTATGAGAGAACCAAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162816506_1162816509 0 Left 1162816506 19:13198628-13198650 CCTTTTGCAGGGCTGCAGGGACA No data
Right 1162816509 19:13198651-13198673 GGTATGAGAGAACCAAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162816509 Original CRISPR GGTATGAGAGAACCAAGAGT GGG Intergenic
No off target data available for this crispr