ID: 1162817901

View in Genome Browser
Species Human (GRCh38)
Location 19:13207472-13207494
Sequence AGTCCTGGGCGAGCGCCCGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162817897_1162817901 -10 Left 1162817897 19:13207459-13207481 CCGAGGCCCGGGGAGTCCTGGGC 0: 1
1: 0
2: 4
3: 30
4: 323
Right 1162817901 19:13207472-13207494 AGTCCTGGGCGAGCGCCCGGTGG 0: 1
1: 0
2: 0
3: 6
4: 93
1162817895_1162817901 -9 Left 1162817895 19:13207458-13207480 CCCGAGGCCCGGGGAGTCCTGGG 0: 1
1: 0
2: 7
3: 38
4: 383
Right 1162817901 19:13207472-13207494 AGTCCTGGGCGAGCGCCCGGTGG 0: 1
1: 0
2: 0
3: 6
4: 93
1162817886_1162817901 16 Left 1162817886 19:13207433-13207455 CCGAGAAGGCGAGGCGCAGGCCG 0: 1
1: 0
2: 3
3: 5
4: 108
Right 1162817901 19:13207472-13207494 AGTCCTGGGCGAGCGCCCGGTGG 0: 1
1: 0
2: 0
3: 6
4: 93
1162817884_1162817901 21 Left 1162817884 19:13207428-13207450 CCGTGCCGAGAAGGCGAGGCGCA 0: 1
1: 0
2: 0
3: 7
4: 43
Right 1162817901 19:13207472-13207494 AGTCCTGGGCGAGCGCCCGGTGG 0: 1
1: 0
2: 0
3: 6
4: 93
1162817882_1162817901 25 Left 1162817882 19:13207424-13207446 CCGGCCGTGCCGAGAAGGCGAGG 0: 1
1: 0
2: 2
3: 6
4: 65
Right 1162817901 19:13207472-13207494 AGTCCTGGGCGAGCGCCCGGTGG 0: 1
1: 0
2: 0
3: 6
4: 93
1162817893_1162817901 -4 Left 1162817893 19:13207453-13207475 CCGGGCCCGAGGCCCGGGGAGTC 0: 1
1: 0
2: 1
3: 17
4: 221
Right 1162817901 19:13207472-13207494 AGTCCTGGGCGAGCGCCCGGTGG 0: 1
1: 0
2: 0
3: 6
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162817901 Original CRISPR AGTCCTGGGCGAGCGCCCGG TGG Exonic
901019103 1:6246938-6246960 ACTCCAGGGCGGGCGCGCGGGGG + Intergenic
904004670 1:27357483-27357505 GCTCCTGGGCGAGCTGCCGGCGG + Exonic
906521017 1:46466872-46466894 AGTCCCGGCCGCCCGCCCGGGGG - Intergenic
908523483 1:64966426-64966448 AGCCCTGGGCGCGCGCACGCTGG - Exonic
909765421 1:79349605-79349627 AGGCATGAGCCAGCGCCCGGCGG + Intergenic
921384054 1:214551768-214551790 AGCGCTGGGCGCGCGGCCGGGGG + Intronic
1065342898 10:24723404-24723426 AGCCCGCGGCGGGCGCCCGGCGG - Intronic
1066672822 10:37857971-37857993 AGCACTGGGCGAGGGCCAGGGGG - Intronic
1073074480 10:100815207-100815229 AGCCCTTGGCCAGCCCCCGGGGG + Intronic
1076864610 10:133160613-133160635 GGTCCGCGGAGAGCGCCCGGGGG + Intronic
1077502947 11:2917382-2917404 AGTCCAGGGGGAGGGCCGGGTGG + Intronic
1083729003 11:64643098-64643120 AAACCCGGGGGAGCGCCCGGGGG + Intronic
1083936612 11:65872865-65872887 ATTCCTGAGCCAGCGCCAGGGGG + Exonic
1085266011 11:75238561-75238583 AGTCCTGGGCAAGGACCCTGGGG + Intergenic
1085284581 11:75351562-75351584 AGTGCAGGGCGGCCGCCCGGCGG - Intronic
1086552472 11:88069092-88069114 GGGCCAGGGCGAGCTCCCGGTGG + Intergenic
1089525516 11:119094468-119094490 AGTCCAGGCCGAGAGGCCGGCGG - Exonic
1090788591 11:130070395-130070417 AGGGCGGGGCGGGCGCCCGGGGG - Intronic
1092104388 12:5911086-5911108 AGTCCTGGGAGAGTGACCGATGG - Intronic
1103961669 12:124612731-124612753 AGACCTGGGCGTGCTCCCAGTGG + Intergenic
1104354172 12:128070784-128070806 AGGCCTGGGCATGGGCCCGGTGG - Intergenic
1105019359 12:132805633-132805655 TGTGCTGGGAGAGCGCCTGGGGG - Intronic
1105481122 13:20776714-20776736 AATCCTGGCCGGGCGCGCGGTGG - Intergenic
1105545058 13:21345129-21345151 AGTCCTGGGCTAGCTGCAGGAGG - Intergenic
1112415507 13:99200733-99200755 AGTCAGGGGCGTGCGCCCGCTGG - Intergenic
1118770040 14:68936680-68936702 AGTCCTGGGCAAGAAGCCGGAGG + Intronic
1119349152 14:73949992-73950014 AGGCCTGAGGGAGCCCCCGGAGG - Exonic
1119744443 14:77033978-77034000 AGGCCCAGGCGCGCGCCCGGCGG - Intergenic
1122228428 14:100292924-100292946 AGTCGTGGCCCAGGGCCCGGAGG + Exonic
1122645130 14:103189135-103189157 AGGCCTGGGCGGGCGCAGGGAGG + Intergenic
1122719955 14:103716227-103716249 TGTCCAGGGCGGGCGCCGGGAGG + Intronic
1128199434 15:65792162-65792184 AGGCCTGGGCGGGCGGGCGGGGG - Intronic
1129612316 15:77070788-77070810 GGGCCTGGGCGGGCGCGCGGGGG - Intronic
1131694074 15:94856405-94856427 AGGCCAGGGCGAGGGGCCGGAGG + Intergenic
1132899238 16:2244349-2244371 TGTTCTGGGCCAGCGCCAGGGGG - Intronic
1133046290 16:3090062-3090084 GGTCCTGGGCGTGCGCCAGCAGG + Exonic
1141657740 16:85425063-85425085 AGTCCTGGGTGAGTGGCCCGGGG - Intergenic
1142233810 16:88912073-88912095 AGCCCTGGGCCGGGGCCCGGAGG - Intronic
1142425842 16:90001860-90001882 TGTCCTGGGTGAGCGGCCGGAGG + Intergenic
1145167315 17:20624403-20624425 AGTGCTGGCTGAGAGCCCGGTGG + Intergenic
1149537019 17:57441007-57441029 AGCCCTGGGAGAGCGGCAGGGGG - Intronic
1152320982 17:79608808-79608830 AGTCCTGGGGGAGGGGCGGGGGG + Intergenic
1152559048 17:81068736-81068758 AGTCCTGCGGGAGGGCCTGGGGG + Intronic
1154059511 18:11046600-11046622 AGACCTGAGCGAGCACCCAGCGG - Intronic
1162285612 19:9736403-9736425 AGTCCGGGGCCAGGGCGCGGTGG - Intergenic
1162817901 19:13207472-13207494 AGTCCTGGGCGAGCGCCCGGTGG + Exonic
1163736351 19:18983601-18983623 AGTCCAGGGTGGGCACCCGGGGG - Intergenic
1165902336 19:39174677-39174699 AGTCCTGGGCTAGTGCTGGGGGG - Intronic
1167148535 19:47696180-47696202 AGCCCTGGGCGAGGGGACGGAGG + Intronic
1167158771 19:47754771-47754793 AGGCCAGGGCGAGGGGCCGGAGG + Exonic
1167233224 19:48298043-48298065 AGTGCTGGGCCAGAGCCTGGAGG - Exonic
925016132 2:525672-525694 AGTCCTGGGCCAGCTCCCTGTGG - Intergenic
927567627 2:24126909-24126931 AATCTTGGCCGGGCGCCCGGTGG - Intronic
933139777 2:78779036-78779058 AGGCCAGCGCGAGCTCCCGGTGG + Intergenic
946412527 2:219522429-219522451 ACCCCTGGGCGACTGCCCGGTGG + Intronic
947717612 2:232349778-232349800 TGTCCTGGGCCAGCGCCTGGAGG - Intergenic
947728716 2:232416649-232416671 CATCCTGGGCCAGCGCCTGGAGG - Intergenic
947740678 2:232483463-232483485 CATCCTGGGCCAGCGCCTGGAGG - Exonic
948589589 2:239040463-239040485 AGTCTTAGGGGAGCCCCCGGGGG - Intergenic
1170226421 20:13995825-13995847 AGTCCTGGGGGTGCGGGCGGTGG + Intronic
1176118898 20:63445395-63445417 AGGCCTGGGGGAGGGCCTGGGGG + Intronic
1179658321 21:42859484-42859506 AGTCCTGAGTGAGCGGCCGCAGG + Intronic
1181583798 22:23842146-23842168 ACGCCTGGGCGGGCGCCCGGTGG + Intergenic
1183327612 22:37202974-37202996 AGTCCTGGTCCAGAGCCTGGTGG + Intergenic
1184433946 22:44458702-44458724 AGCCCTGGGCGATCGGCCCGCGG + Intergenic
961559869 3:127721256-127721278 AGTCCTGGCCAAGAGCCCTGAGG + Intronic
963939917 3:151087166-151087188 GGTGCTGGGCGACCCCCCGGCGG + Intronic
967076592 3:186008854-186008876 AGTCCTGGGTGAGGCCCCAGGGG - Intergenic
968619358 4:1596943-1596965 TGCCCAGGGCGAGCCCCCGGGGG - Intergenic
982421811 4:155208083-155208105 AGCCCTGGGCGAGGGTGCGGAGG + Intergenic
989104054 5:37844239-37844261 AGTCCTTGGCGAGCTCCCAGTGG + Intergenic
990545189 5:56815431-56815453 AGTCCAGGCCAGGCGCCCGGCGG + Intergenic
997374211 5:133385151-133385173 AGGCCTAGTCGAGGGCCCGGTGG - Intronic
1002208983 5:177584645-177584667 AGTCCTGGGGGAGCCACAGGTGG - Intergenic
1002418319 5:179132406-179132428 GGTCCTGGGAGAGCCTCCGGAGG - Intronic
1002661253 5:180792383-180792405 AGACCTGGCCCAGCGCCCAGCGG + Exonic
1007635640 6:43298204-43298226 AGTCCTGGGCCAGCCCCTGAGGG + Intronic
1013048904 6:106512713-106512735 ACTCCTTGGCGGGAGCCCGGGGG - Exonic
1017068160 6:150549184-150549206 AGTCCTAGGGGAGCCCCCGTTGG + Intergenic
1017971494 6:159315812-159315834 AGTCCAGGGCGAGTGCGAGGAGG - Intergenic
1019641716 7:2106901-2106923 AGACCTGGGCAGGGGCCCGGGGG + Intronic
1019643077 7:2115171-2115193 GGTCCTGAGCCAGCGCCCCGTGG - Intronic
1019755110 7:2763012-2763034 AGTCCTGGGCCAGTGGCCGGCGG - Intronic
1021740908 7:23684233-23684255 AGGCCTGGGCAAACGCTCGGTGG + Intronic
1022235227 7:28454467-28454489 AGTCCTGGGGGAATGCCCTGAGG - Intronic
1023243775 7:38178550-38178572 AGTCCTGCGCGAGCCTCCAGGGG + Intronic
1033306581 7:140230262-140230284 AGCCCAGGGCCCGCGCCCGGAGG - Intergenic
1035053509 7:156018371-156018393 AGTCCTGGGAAAGTGCCAGGTGG - Intergenic
1035431984 7:158829388-158829410 CGCCCGGGGCGAGGGCCCGGAGG - Exonic
1035467116 7:159086721-159086743 GGTCCTGGGCAGGCGCTCGGAGG - Intronic
1035740631 8:1925614-1925636 AGTCCTGGGCCAGGACCCTGGGG + Intronic
1037807371 8:22066321-22066343 CTTCCTGGGCGAGCGCGGGGAGG + Intronic
1041690254 8:60679979-60680001 GGGCCGGGGCGAGCGCCGGGAGG + Intronic
1050388271 9:5112170-5112192 AGCCCAAGGCCAGCGCCCGGTGG - Intronic
1057600325 9:96451089-96451111 AGGCCTGGGCGACCGCGGGGCGG + Intronic
1060096212 9:120793145-120793167 TGACCTGAGCGAGCGCCCCGGGG + Exonic
1060556947 9:124512887-124512909 AGGCCTGGGGGAGCCCCCGTAGG + Intergenic
1061961700 9:133992060-133992082 TGTCCCAGGTGAGCGCCCGGCGG - Exonic
1062387278 9:136317838-136317860 GGTCCTGGGAGAGCCCCCGAGGG - Intergenic
1062567603 9:137170229-137170251 AGGGCTCGGCGGGCGCCCGGTGG - Intronic