ID: 1162818438

View in Genome Browser
Species Human (GRCh38)
Location 19:13209388-13209410
Sequence TCCCGCCCGAGGAGAACCAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162818438_1162818448 18 Left 1162818438 19:13209388-13209410 CCGCTGGTTCTCCTCGGGCGGGA 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1162818448 19:13209429-13209451 CGTCCAGGCGTCGGGCCTTGGGG 0: 1
1: 0
2: 0
3: 4
4: 55
1162818438_1162818445 10 Left 1162818438 19:13209388-13209410 CCGCTGGTTCTCCTCGGGCGGGA 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1162818445 19:13209421-13209443 CGAGTAATCGTCCAGGCGTCGGG 0: 1
1: 0
2: 0
3: 1
4: 8
1162818438_1162818444 9 Left 1162818438 19:13209388-13209410 CCGCTGGTTCTCCTCGGGCGGGA 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1162818444 19:13209420-13209442 GCGAGTAATCGTCCAGGCGTCGG 0: 1
1: 0
2: 0
3: 0
4: 9
1162818438_1162818442 3 Left 1162818438 19:13209388-13209410 CCGCTGGTTCTCCTCGGGCGGGA 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1162818442 19:13209414-13209436 GCTCCAGCGAGTAATCGTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 26
1162818438_1162818450 28 Left 1162818438 19:13209388-13209410 CCGCTGGTTCTCCTCGGGCGGGA 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1162818450 19:13209439-13209461 TCGGGCCTTGGGGCCCAGCACGG 0: 1
1: 0
2: 1
3: 20
4: 256
1162818438_1162818447 17 Left 1162818438 19:13209388-13209410 CCGCTGGTTCTCCTCGGGCGGGA 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1162818447 19:13209428-13209450 TCGTCCAGGCGTCGGGCCTTGGG 0: 1
1: 0
2: 0
3: 5
4: 31
1162818438_1162818446 16 Left 1162818438 19:13209388-13209410 CCGCTGGTTCTCCTCGGGCGGGA 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1162818446 19:13209427-13209449 ATCGTCCAGGCGTCGGGCCTTGG 0: 1
1: 0
2: 0
3: 6
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162818438 Original CRISPR TCCCGCCCGAGGAGAACCAG CGG (reversed) Exonic