ID: 1162819198

View in Genome Browser
Species Human (GRCh38)
Location 19:13212497-13212519
Sequence GGCTCACGAAAGCGGCCTCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 95}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162819198_1162819205 -2 Left 1162819198 19:13212497-13212519 CCTTGAGGCCGCTTTCGTGAGCC 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1162819205 19:13212518-13212540 CCATCCTGCATGGGGGACAGAGG 0: 1
1: 0
2: 2
3: 43
4: 787
1162819198_1162819208 3 Left 1162819198 19:13212497-13212519 CCTTGAGGCCGCTTTCGTGAGCC 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1162819208 19:13212523-13212545 CTGCATGGGGGACAGAGGCCGGG 0: 1
1: 0
2: 4
3: 67
4: 769
1162819198_1162819203 -9 Left 1162819198 19:13212497-13212519 CCTTGAGGCCGCTTTCGTGAGCC 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1162819203 19:13212511-13212533 TCGTGAGCCATCCTGCATGGGGG 0: 1
1: 0
2: 0
3: 10
4: 142
1162819198_1162819209 4 Left 1162819198 19:13212497-13212519 CCTTGAGGCCGCTTTCGTGAGCC 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1162819209 19:13212524-13212546 TGCATGGGGGACAGAGGCCGGGG 0: 1
1: 0
2: 1
3: 33
4: 371
1162819198_1162819213 21 Left 1162819198 19:13212497-13212519 CCTTGAGGCCGCTTTCGTGAGCC 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1162819213 19:13212541-13212563 CCGGGGTAGCAGTGGGCGCTTGG 0: 1
1: 0
2: 0
3: 8
4: 130
1162819198_1162819211 14 Left 1162819198 19:13212497-13212519 CCTTGAGGCCGCTTTCGTGAGCC 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1162819211 19:13212534-13212556 ACAGAGGCCGGGGTAGCAGTGGG 0: 1
1: 0
2: 1
3: 26
4: 217
1162819198_1162819210 13 Left 1162819198 19:13212497-13212519 CCTTGAGGCCGCTTTCGTGAGCC 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1162819210 19:13212533-13212555 GACAGAGGCCGGGGTAGCAGTGG 0: 1
1: 0
2: 2
3: 39
4: 350
1162819198_1162819214 22 Left 1162819198 19:13212497-13212519 CCTTGAGGCCGCTTTCGTGAGCC 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1162819214 19:13212542-13212564 CGGGGTAGCAGTGGGCGCTTGGG 0: 1
1: 0
2: 0
3: 6
4: 93
1162819198_1162819202 -10 Left 1162819198 19:13212497-13212519 CCTTGAGGCCGCTTTCGTGAGCC 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1162819202 19:13212510-13212532 TTCGTGAGCCATCCTGCATGGGG 0: 1
1: 0
2: 0
3: 9
4: 65
1162819198_1162819207 2 Left 1162819198 19:13212497-13212519 CCTTGAGGCCGCTTTCGTGAGCC 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1162819207 19:13212522-13212544 CCTGCATGGGGGACAGAGGCCGG 0: 1
1: 1
2: 6
3: 78
4: 1790

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162819198 Original CRISPR GGCTCACGAAAGCGGCCTCA AGG (reversed) Exonic
902867561 1:19289196-19289218 GGCTCAAGACAGCGTCCCCATGG + Exonic
906802051 1:48746448-48746470 GGCTCACGAAGGTGTCCTAAGGG + Intronic
906821963 1:48939501-48939523 AGCTCAAGAAAGGGGCCTCCAGG + Intronic
913697948 1:121346143-121346165 GGCTAATGGAAGCAGCCTCAGGG - Intronic
922819881 1:228476881-228476903 GGCTCAGGAGAGACGCCTCAGGG + Intergenic
1068054006 10:51987838-51987860 GGTTCAAGAAAACGGCCACAAGG + Intronic
1076155615 10:128202872-128202894 AGATCATGAAAGCAGCCTCAGGG + Intergenic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1078826931 11:14938629-14938651 GGCTCATGAAAGTAGCCACAAGG - Intronic
1085600812 11:77854655-77854677 AGCCCACGAAAGCAGCCACAGGG - Intronic
1092284446 12:7120724-7120746 GGGTTATGAAAGTGGCCTCACGG + Intergenic
1095226682 12:39686053-39686075 AGCTCATGAAAGCAGCCACAGGG - Intronic
1097815239 12:64066776-64066798 GGCTCTCAAACGCTGCCTCAAGG - Intronic
1102825913 12:115947798-115947820 GGATCAGGAAAACGACCTCATGG + Intergenic
1109476118 13:62882284-62882306 AGCCCATGAAAGCAGCCTCAAGG - Intergenic
1113899718 13:113789521-113789543 GCCTCACGAGAGCTGCCTCAGGG - Intronic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1121244406 14:92451738-92451760 GGCTCACCAAAGCAGCCTCCTGG + Intronic
1122503330 14:102216234-102216256 AGCTCTCAAAAGCGGCCTCCTGG + Intronic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202860687 14_GL000225v1_random:79433-79455 GGCCCACGAAAGCCCCCTGAGGG + Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1123629455 15:22251096-22251118 GGCTCAGGCTAGCAGCCTCACGG - Intergenic
1126490613 15:49231881-49231903 AGCCCATGAAAGCAGCCTCAGGG - Intronic
1132572248 16:649233-649255 CGCTCACGTCAGCGGCCTCCAGG - Intronic
1141974102 16:87503340-87503362 GGCTCAGGCTAGCAGCCTCACGG + Intergenic
1144458337 17:15437111-15437133 CACTCACAAAAGCAGCCTCATGG + Exonic
1149712669 17:58756691-58756713 GGCTCAGGAGAGCGGCTTCAAGG - Intronic
1150885879 17:69085042-69085064 GGCTCAGGAAAGCGGACGCGAGG - Exonic
1150984167 17:70176418-70176440 GGGTCAAGCAAGCGGCCACAAGG + Exonic
1156363865 18:36408065-36408087 GGCTCTGGAAGGCGGTCTCAGGG - Intronic
1160973408 19:1780384-1780406 GGCTCAGGGACGTGGCCTCATGG - Exonic
1161459238 19:4386726-4386748 GGCTCAGGAAAGAGGGCTGATGG - Intronic
1162819198 19:13212497-13212519 GGCTCACGAAAGCGGCCTCAAGG - Exonic
1166992471 19:46700896-46700918 GGCTGACAAGAGCGCCCTCATGG - Exonic
927852462 2:26508591-26508613 GGCTCAAGCAAGCAGCATCATGG + Intronic
948095718 2:235332603-235332625 GTCTCAGGAAGGTGGCCTCAGGG - Intergenic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1176153056 20:63602921-63602943 GGCCCAGGAGAGAGGCCTCATGG - Intronic
1177188596 21:17824635-17824657 AGCTCATGAAAGCAGCCTCAGGG - Intergenic
1179573844 21:42294538-42294560 GGCCCACGAAAGTGGCCACCTGG - Exonic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG + Intergenic
1182128390 22:27833160-27833182 GGCTCACCAAAACCGCCTCCCGG + Intergenic
949262123 3:2115082-2115104 GGCTCATCAGAGAGGCCTCATGG - Intronic
955539333 3:59957349-59957371 TGCTCACAAGAGGGGCCTCAGGG + Intronic
961539163 3:127588958-127588980 AGCTCACGATAGGGGCCTAAGGG + Intronic
969224370 4:5785231-5785253 GGCTCACGCAGGCTGCCTCTAGG - Intronic
974310943 4:60209383-60209405 AGCTCATGAAAGCAGCCACAGGG - Intergenic
974469178 4:62296601-62296623 AGCTCATGAAAGCAGCCACAAGG - Intergenic
978809795 4:112837576-112837598 AGCCCATGAAAGCAGCCTCAGGG + Intronic
981898681 4:149835597-149835619 GGCTCAAGACAGCGCCCTCAAGG + Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
990213663 5:53507812-53507834 AGCTCATGAAAGCAGCCACAGGG - Intergenic
1004923214 6:20395896-20395918 GGCACAAGAAAGGGTCCTCAGGG + Intergenic
1005397360 6:25397011-25397033 AGCTCATGAGAGCGGCATCAAGG + Intronic
1006087056 6:31603531-31603553 GTCTCAAGAAAGAGGCCTGAGGG - Intergenic
1008286622 6:49660648-49660670 GGCTCAGGAAAGCTGCCTGGGGG - Intergenic
1015901797 6:138075336-138075358 AGCTCACGAAAGCAGCCAGAAGG + Intergenic
1019271027 7:149362-149384 GGCTCACAGAGGCCGCCTCAGGG + Intergenic
1019318357 7:401936-401958 GGCTCAGGAAAAAGGCCTCAGGG + Intergenic
1019633749 7:2064476-2064498 GGCTCACAAGAGCTGCCTCTGGG + Intronic
1021763811 7:23927278-23927300 GGCTCAGGACAGCAGCCCCATGG - Intergenic
1030752226 7:113242054-113242076 AGCTCATGAAAGCAGCCGCAGGG + Intergenic
1032856022 7:135834213-135834235 GGCTCAAAAAAGCAGCCCCAAGG - Intergenic
1042814266 8:72861456-72861478 AGCTCACGAAAGAAGCCTGATGG + Intronic
1048879266 8:138859477-138859499 GCCTCACCAAAGCTGCCTCAGGG - Intronic
1050402506 9:5271114-5271136 AGCCCATGAAAGCAGCCTCAGGG + Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1062650499 9:137574275-137574297 GGCTGCAGAAAGTGGCCTCATGG - Exonic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1203377280 Un_KI270442v1:385682-385704 GGCTCACGAAAGCCCCCACTGGG + Intergenic
1188833356 X:34928147-34928169 AGCTCATGAAAGCAGCCACAGGG - Intergenic
1190308685 X:49101562-49101584 CGCGCACGAAAGCGTCCACATGG - Intergenic
1199642894 X:149881247-149881269 GGCTGAGGGAAGCGGGCTCAGGG + Exonic
1199816852 X:151405023-151405045 GGCTCACGACAGTGGCGTGAAGG + Exonic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic