ID: 1162822606

View in Genome Browser
Species Human (GRCh38)
Location 19:13232110-13232132
Sequence TTGGTCTAGGGTGGGATTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 219}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162822598_1162822606 -2 Left 1162822598 19:13232089-13232111 CCCCAGCAGACTTGGATTCAGTT 0: 1
1: 0
2: 0
3: 17
4: 169
Right 1162822606 19:13232110-13232132 TTGGTCTAGGGTGGGATTTGAGG 0: 1
1: 0
2: 1
3: 22
4: 219
1162822592_1162822606 9 Left 1162822592 19:13232078-13232100 CCCGTGCCCCACCCCAGCAGACT 0: 1
1: 0
2: 9
3: 43
4: 374
Right 1162822606 19:13232110-13232132 TTGGTCTAGGGTGGGATTTGAGG 0: 1
1: 0
2: 1
3: 22
4: 219
1162822593_1162822606 8 Left 1162822593 19:13232079-13232101 CCGTGCCCCACCCCAGCAGACTT 0: 1
1: 0
2: 6
3: 60
4: 538
Right 1162822606 19:13232110-13232132 TTGGTCTAGGGTGGGATTTGAGG 0: 1
1: 0
2: 1
3: 22
4: 219
1162822599_1162822606 -3 Left 1162822599 19:13232090-13232112 CCCAGCAGACTTGGATTCAGTTG 0: 1
1: 0
2: 0
3: 13
4: 132
Right 1162822606 19:13232110-13232132 TTGGTCTAGGGTGGGATTTGAGG 0: 1
1: 0
2: 1
3: 22
4: 219
1162822597_1162822606 1 Left 1162822597 19:13232086-13232108 CCACCCCAGCAGACTTGGATTCA 0: 1
1: 0
2: 0
3: 13
4: 152
Right 1162822606 19:13232110-13232132 TTGGTCTAGGGTGGGATTTGAGG 0: 1
1: 0
2: 1
3: 22
4: 219
1162822591_1162822606 15 Left 1162822591 19:13232072-13232094 CCAATGCCCGTGCCCCACCCCAG No data
Right 1162822606 19:13232110-13232132 TTGGTCTAGGGTGGGATTTGAGG 0: 1
1: 0
2: 1
3: 22
4: 219
1162822595_1162822606 3 Left 1162822595 19:13232084-13232106 CCCCACCCCAGCAGACTTGGATT 0: 1
1: 0
2: 0
3: 22
4: 217
Right 1162822606 19:13232110-13232132 TTGGTCTAGGGTGGGATTTGAGG 0: 1
1: 0
2: 1
3: 22
4: 219
1162822596_1162822606 2 Left 1162822596 19:13232085-13232107 CCCACCCCAGCAGACTTGGATTC 0: 1
1: 0
2: 3
3: 18
4: 173
Right 1162822606 19:13232110-13232132 TTGGTCTAGGGTGGGATTTGAGG 0: 1
1: 0
2: 1
3: 22
4: 219
1162822600_1162822606 -4 Left 1162822600 19:13232091-13232113 CCAGCAGACTTGGATTCAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1162822606 19:13232110-13232132 TTGGTCTAGGGTGGGATTTGAGG 0: 1
1: 0
2: 1
3: 22
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162822606 Original CRISPR TTGGTCTAGGGTGGGATTTG AGG Intronic
900754928 1:4426802-4426824 TTGGTCTGGGTTTGAATTTGAGG - Intergenic
901090447 1:6637404-6637426 TTGGTCCAGGGTGGGCGCTGGGG - Intronic
902321465 1:15670181-15670203 ATTGCCTGGGGTGGGATTTGGGG - Intergenic
902638764 1:17752697-17752719 TTGTTCTAGGGTGGACATTGTGG + Intergenic
903305290 1:22408774-22408796 TTGCTCTAGGGTTGGTTTGGAGG + Intergenic
903973213 1:27132763-27132785 TTGGCCTAGGGTGGGAGTTGGGG - Intronic
904570394 1:31459955-31459977 TGGGTCTGGGATGGGGTTTGGGG - Intergenic
904789901 1:33011718-33011740 TTGGTCTCTGGTTTGATTTGTGG - Intronic
905398597 1:37685076-37685098 TCGTTCTAGGGTAAGATTTGGGG - Intronic
905471334 1:38194339-38194361 TTGGTGTGGGTTAGGATTTGTGG - Intergenic
905959282 1:42030143-42030165 TTGCTCTAGGGTGTGCTGTGTGG - Intronic
906297084 1:44655460-44655482 TTGGCCTGGAGTGGTATTTGAGG + Intronic
907934769 1:59032419-59032441 TTGGACCAGAGTGGTATTTGAGG - Intergenic
908262841 1:62352305-62352327 TTGGTCTAGGCTGGGCATGGTGG - Intergenic
909767876 1:79380306-79380328 TTGGTCTTGACTGGGATCTGAGG + Intergenic
910480416 1:87652677-87652699 TGGGACTAGTATGGGATTTGAGG + Intergenic
910657883 1:89636617-89636639 TTGGTCAAGGGTGAGGTGTGTGG - Intronic
911254356 1:95617122-95617144 TTTATCTAGGGTGGGATTGCTGG - Intergenic
911356565 1:96828154-96828176 CTGATCTGGGTTGGGATTTGTGG - Intergenic
911556475 1:99351422-99351444 ATGGTCTAGGGTGAGAATAGAGG - Intergenic
911596693 1:99805911-99805933 TGTGTCAAGGGTGGGATTGGGGG - Intergenic
912436191 1:109662853-109662875 TTCCTATAGGGTGGGATTTCTGG - Intronic
912438246 1:109677289-109677311 TTCCTGTAGGGTGGGATTTCTGG - Intronic
912475453 1:109931701-109931723 TTGATCTAGGGTGGGGCTCGGGG - Intergenic
915196691 1:154194843-154194865 TTGGTATATGCTGGGGTTTGGGG - Intergenic
917151175 1:171946467-171946489 TTGGTGTGGTGTGGTATTTGGGG + Intronic
920234181 1:204492083-204492105 TGGGGATAGGGTGGGATCTGAGG - Intronic
921884727 1:220294013-220294035 CGGTTCTAGGGTGTGATTTGAGG + Intergenic
924019946 1:239770427-239770449 TTGGTTTAACTTGGGATTTGAGG + Intronic
1068304483 10:55188016-55188038 TAGGTCTAGGGTGGTAGTTTTGG + Intronic
1068971531 10:62963297-62963319 GTGGTCTAGGGTTGGTTTGGAGG + Intergenic
1070331073 10:75417673-75417695 TTGGTGTGGGGTGGGAATTTGGG + Intergenic
1070401770 10:76059102-76059124 TTGGGCATGGGTGGGCTTTGGGG + Intronic
1070661078 10:78305652-78305674 TGGGTCTAGGGTGAAATTTTAGG + Intergenic
1072299019 10:94041152-94041174 AGGGTCCAGGGTGGGAGTTGGGG - Intronic
1072520140 10:96223845-96223867 TTGGGTTTGGGTGGGACTTGAGG + Exonic
1074779127 10:116787929-116787951 TTGGTCTATGGTGGAAGTTGGGG + Intergenic
1075475946 10:122734033-122734055 ATGGAGTGGGGTGGGATTTGGGG - Intergenic
1075510923 10:123072661-123072683 GTGGGCGAGGGTGGGATTTGCGG - Intergenic
1076176471 10:128372150-128372172 TTGGGCTAGGGTGGGCTCCGAGG + Intergenic
1076776763 10:132701997-132702019 TGGGTTTAGGGTGGGATGCGCGG - Intronic
1077268708 11:1665221-1665243 CTGCTCTCAGGTGGGATTTGGGG + Intergenic
1077272067 11:1686082-1686104 CTGCTCTCAGGTGGGATTTGGGG - Intergenic
1079287947 11:19156752-19156774 TTGGTCTAGGATGCGAGTTGTGG - Intronic
1079435116 11:20439333-20439355 TTGATCCTGGCTGGGATTTGGGG + Intronic
1086045557 11:82527373-82527395 TTGGTCTATGTGGGTATTTGTGG - Intergenic
1087407195 11:97745241-97745263 TGGGTCTAGCTTGGGGTTTGTGG - Intergenic
1087572660 11:99949452-99949474 TTGGTTAAGGCAGGGATTTGGGG + Intronic
1087825853 11:102764062-102764084 TGTGTCTAGGGTGGGCTTTAAGG - Intergenic
1088455657 11:110030460-110030482 AGGGTCAAGGGTGGGATTTAGGG + Intergenic
1089162355 11:116448551-116448573 TTTGTATATGGTGGGATGTGTGG - Intergenic
1089173992 11:116535361-116535383 TTGGCCTTGGGTGGGGATTGTGG + Intergenic
1089300995 11:117498435-117498457 GTGGTCTAGAAAGGGATTTGTGG + Intronic
1089592712 11:119554928-119554950 TGCCCCTAGGGTGGGATTTGGGG + Intergenic
1091202317 11:133791186-133791208 TTTGTCTAAGTTGGGACTTGTGG - Intergenic
1092752887 12:11735342-11735364 TTGGTCTTTGGTGAGATTAGTGG + Intronic
1093137253 12:15467523-15467545 TAGGACTAGGGTGGTATTGGGGG - Intronic
1097140450 12:56898459-56898481 TTGCTCTAGGGTGAGAACTGTGG + Intergenic
1097822957 12:64146040-64146062 TTGGACTGGGTTGGGGTTTGGGG + Exonic
1098534733 12:71581877-71581899 TTGGTCTCATGTGGGAATTGGGG - Intronic
1099759821 12:86904984-86905006 TTTATCTAGGGTGGATTTTGGGG + Intergenic
1099796143 12:87402445-87402467 TTGGTCTATGTTTGGTTTTGGGG + Intergenic
1101072241 12:101087867-101087889 TTGGACCAGGGTGGGACTTCGGG - Intronic
1101400049 12:104379312-104379334 TAGGTCTGGGGTGGGGTCTGGGG + Intergenic
1101473859 12:105025242-105025264 TTGATCTGGGGTGTGATGTGGGG - Intronic
1102922710 12:116804302-116804324 TAGGTCTGGGGTGGGGTCTGAGG - Intronic
1104416286 12:128598845-128598867 TGGGGCTGGGGTGGGGTTTGGGG + Intronic
1106465085 13:30006386-30006408 TTGGTCTGGTTTGGGGTTTGGGG + Intergenic
1107066183 13:36216014-36216036 TTGGTGTAGGGTGTGAATTGAGG + Intronic
1107833194 13:44392522-44392544 TTGGACTAGGGTGGCTTCTGAGG + Intronic
1109443155 13:62400463-62400485 TTGGTGTAGAGTGGGACTAGAGG - Intergenic
1109799974 13:67363788-67363810 TTGGTCTATTGTAGGAATTGAGG - Intergenic
1110647525 13:77905628-77905650 TTGAGTGAGGGTGGGATTTGAGG + Intronic
1118818682 14:69330621-69330643 CTGATCTAGGGTGGGAACTGAGG + Intronic
1119284343 14:73440051-73440073 TTGGTCTAGAGTGGCAGTTGGGG - Intronic
1119939156 14:78622225-78622247 TTTGTCTTGGGTGAGAATTGAGG - Intronic
1120690865 14:87590802-87590824 GAGGTTTAGGGAGGGATTTGGGG - Intergenic
1124930687 15:34116306-34116328 TTGTTCCTGGGTGGGCTTTGAGG + Intergenic
1125032633 15:35087865-35087887 TTGGACTGGGGTGGCCTTTGGGG + Intergenic
1125271300 15:37941462-37941484 TTGGTCAAAGGTGGAATTTGGGG - Intronic
1126995681 15:54441225-54441247 TTGGTCTAGGCTAGGATTTCAGG - Intronic
1128163801 15:65442997-65443019 TTGGTATAGTGGAGGATTTGAGG - Exonic
1129005261 15:72367528-72367550 TTGCTGTAGAGTGGGATTAGAGG - Intronic
1131329153 15:91480247-91480269 GTGGGCTGGGGGGGGATTTGGGG + Intergenic
1131547417 15:93327530-93327552 TAGGTCTAGGGTGAGGTCTGAGG - Intergenic
1134196587 16:12163672-12163694 TTGGTCTAGGGTGGGGTCTTGGG + Intronic
1135818467 16:25657733-25657755 TTGGTTAAGGGTGGGACTTTTGG - Intergenic
1136501323 16:30670845-30670867 TTGGACCAGGGTGGGGTGTGTGG + Intergenic
1138496788 16:57413780-57413802 CTGGTCTAGGGAAGGATGTGAGG + Intronic
1140238176 16:73177637-73177659 TTGGTCTAGTCTGAGATCTGTGG - Intergenic
1141443497 16:84043951-84043973 TTGGTGCGGGGTGGGAGTTGGGG - Intergenic
1142242515 16:88954115-88954137 TTGGTCAGTGGTGAGATTTGGGG - Intronic
1143192439 17:5049806-5049828 TGGGGCAAGGGTGGGATTGGAGG + Intronic
1143623809 17:8096600-8096622 TTCTTCTTGGGTGGTATTTGGGG + Exonic
1145888190 17:28397031-28397053 ATGGGGTAGGGTGGGCTTTGAGG - Exonic
1146276785 17:31521369-31521391 TTGGTCTGGGATGTCATTTGGGG + Intronic
1150525167 17:65915356-65915378 TGGGACTAGGGTGGGAGTGGTGG - Intronic
1155741129 18:29289159-29289181 TTTGGTGAGGGTGGGATTTGGGG + Intergenic
1157060389 18:44281382-44281404 TTGGCTTATGGTGGGTTTTGTGG + Intergenic
1157202961 18:45674930-45674952 TTTGTCAAGGCTGGGACTTGGGG - Intronic
1157292112 18:46417177-46417199 TTGGACTAGGGTGGCAATCGGGG - Intronic
1158497683 18:57970962-57970984 TTGGTCTGGGGTGGGGTTGGGGG + Intergenic
1160425775 18:78778195-78778217 TGTGTCTAGGGTGGGGGTTGAGG - Intergenic
1161072582 19:2270122-2270144 CTGGTCGAGGGTTGGATTTGCGG + Intronic
1161601111 19:5183551-5183573 TTGTTCTAGCGTGCAATTTGGGG - Intronic
1162822606 19:13232110-13232132 TTGGTCTAGGGTGGGATTTGAGG + Intronic
1164995998 19:32720571-32720593 TGGGGCTAGGGTAGGAGTTGGGG - Intronic
1165195427 19:34098924-34098946 ATGGACTAGGGTGGGGGTTGAGG - Intergenic
1165355656 19:35302347-35302369 TAGGTTTGGGGTGGGATCTGGGG + Intronic
1166105250 19:40594965-40594987 TTGGTCTGGGGTGGGCTCTGTGG + Intronic
1166136214 19:40778597-40778619 TAGATCTGGGGCGGGATTTGAGG + Intronic
1168081348 19:54012497-54012519 GGGGTCTTGGGTGGGAGTTGGGG + Exonic
926219463 2:10925350-10925372 TGGAGCCAGGGTGGGATTTGGGG + Intergenic
926920224 2:17932736-17932758 ATGGTATTGGGTGGGGTTTGTGG + Exonic
927212332 2:20646459-20646481 GTGGCCTAGCGTGGGATGTGAGG - Intronic
929011848 2:37452594-37452616 TTGGTTTGGGGTGAGATTGGAGG + Intergenic
932543666 2:72684261-72684283 TTGGTTTAGTCTGGGATATGAGG - Intronic
932905362 2:75743902-75743924 TTTGTATAGGGTGTGATGTGGGG - Intergenic
933574282 2:84049779-84049801 CTGGACTAGGGTGGTAGTTGGGG + Intergenic
933693737 2:85199545-85199567 TTGGTCTGGGGTGGAGTTTGGGG - Intronic
936007672 2:108905514-108905536 TTGGCCTACGGTGGGGTGTGGGG + Intronic
936569745 2:113603351-113603373 TTGGGTTAGGGTTGGGTTTGGGG - Intergenic
939222630 2:139322017-139322039 GTGGAGTAGGATGGGATTTGTGG + Intergenic
939745328 2:145960401-145960423 TTTGTCTAGCTTGGGGTTTGTGG - Intergenic
939880565 2:147626028-147626050 TTAGTCAAGAGTTGGATTTGTGG - Intergenic
941001748 2:160209346-160209368 TTGGTCTATGGTGGGAGTAAAGG + Intronic
943641549 2:190364562-190364584 TAGGTCTGGGGTGGCATCTGAGG + Intronic
943722897 2:191223454-191223476 TGGGCCTGGGGTGGGGTTTGAGG - Intergenic
943952691 2:194150610-194150632 TTGGTCCTGGGTGGGACATGTGG + Intergenic
945421165 2:209638461-209638483 TTTTTCTAGGGGTGGATTTGGGG - Intronic
947184083 2:227439417-227439439 CTGGTCAAGGGTGGGAGTTCTGG - Intergenic
949056864 2:241932509-241932531 TTGGCCTGGGGCGGGGTTTGGGG + Intergenic
1168842972 20:921472-921494 GGGGCCTAGGGTGGGTTTTGAGG + Intergenic
1169804730 20:9547805-9547827 TAGGTCTGGGGTGGGGCTTGAGG - Intronic
1170189543 20:13631013-13631035 TTGGTTTTGGGTGGTATTTGGGG + Intronic
1172808874 20:37633105-37633127 TGGGTCTAGGGTAGGAGATGAGG + Intergenic
1173007440 20:39151007-39151029 TTGGGGTAGGGTGGGATCTGGGG + Intergenic
1173262138 20:41446033-41446055 TTGGTCCAGGGTGGCATCTTGGG + Intronic
1173264261 20:41464366-41464388 TTGGTCTATAGTGGGTTTTTTGG - Intronic
1174089737 20:48037562-48037584 TGGGTCTGGGGTGGGATGTCAGG + Intergenic
1175303102 20:57956914-57956936 TAGGTCCAGGGTGGGATTCCAGG - Intergenic
1175469623 20:59218189-59218211 CTGGGTTAGGGTGGGATTTGGGG + Intronic
1175979413 20:62729550-62729572 TTGGTCTGGGGTGAGCCTTGGGG - Intronic
1179135023 21:38671781-38671803 GTGGCCTGTGGTGGGATTTGGGG - Intergenic
1179546929 21:42118831-42118853 TGGGGCGAGGGTGGGACTTGGGG - Intronic
1181437287 22:22918225-22918247 TGGGTCTAGGGTGAGATCTGGGG + Intergenic
1184755101 22:46511392-46511414 TTGGTCCCGGTTGGGATTTAAGG - Intronic
949559144 3:5186988-5187010 TAGGTCTAGGGAGGGATCTGGGG + Intergenic
949758208 3:7438342-7438364 TTGGTCATGGGTGAGATATGGGG + Intronic
951584377 3:24200369-24200391 TAGGACTAGGGTATGATTTGTGG + Intronic
952355835 3:32583119-32583141 TTGGACTGGGGTGGGGTCTGAGG + Intergenic
955695028 3:61627297-61627319 TTGGAGTAAGGTGTGATTTGGGG + Intronic
956004908 3:64768522-64768544 TCTGTCCAGGGTGAGATTTGAGG - Intergenic
956274549 3:67483980-67484002 TTGCACTAGTGTGGGATTGGTGG + Intronic
956516330 3:70052541-70052563 TTGGTCAAATGTGAGATTTGGGG + Intergenic
956836380 3:73099573-73099595 TAGGTCTGTGGTGGGATCTGAGG - Intergenic
956862674 3:73339842-73339864 TGGGTCTAGAGTGGCATTTAAGG + Intergenic
957240950 3:77660814-77660836 TTGGTCTATGATGGGAGTGGTGG - Intergenic
957509174 3:81165813-81165835 TTGGACTAGGGTTGTATTTGTGG + Intergenic
958944631 3:100349599-100349621 TTGACCTAGGGAGAGATTTGTGG + Intronic
960765698 3:121127590-121127612 TGGGCCTAGGATGGGATTTAGGG + Intronic
960883963 3:122375523-122375545 TCGGATTAGGGTGGGATATGTGG + Intronic
962378922 3:134881063-134881085 CTGTTCTAGTGGGGGATTTGGGG + Intronic
964394269 3:156228961-156228983 TTGTTCTAGTGTGGAGTTTGGGG + Intronic
964851101 3:161097064-161097086 TAGGTCTAGGGTGGGGCCTGGGG - Intronic
964870674 3:161310947-161310969 GTGGTCTAGAGTAGGGTTTGTGG + Intergenic
965629249 3:170714017-170714039 TTGCTCTCTGGTGGGAATTGCGG + Intronic
967395088 3:188999177-188999199 TTGTTCTAGGGTGGAATCAGTGG + Intronic
972031869 4:34470783-34470805 CAGGTTAAGGGTGGGATTTGTGG + Intergenic
981318355 4:143363846-143363868 TAACTCTAGGGTGGGATGTGGGG - Intronic
982769032 4:159378624-159378646 TGGGTCTAGCTTGGGGTTTGTGG + Intergenic
983072785 4:163289747-163289769 TTTGTCTAGGATGGGATAGGAGG + Intergenic
984623725 4:181981637-181981659 TTGGACTTTGGTGGGATTTGGGG + Intergenic
984955438 4:185040776-185040798 CAGGGCTAGGGTGGGATGTGAGG + Intergenic
985100085 4:186450284-186450306 TTGGCCGAGGGTAGGATCTGTGG - Intronic
985680885 5:1254998-1255020 TTGCCCCATGGTGGGATTTGGGG - Intronic
987171762 5:15266734-15266756 TTGGTTTTGGGTGGGGTCTGGGG + Intergenic
987175980 5:15309982-15310004 TTGGTCTATTGTGGCAATTGAGG + Intergenic
987813320 5:22868245-22868267 TTGGTCTTGGTAGGAATTTGAGG - Intergenic
989306287 5:39960489-39960511 TTGGACTAGGATGGAATTGGGGG - Intergenic
990362015 5:55030219-55030241 TTGGTTTAGGGTGGGATTAAGGG + Intronic
990519930 5:56569478-56569500 TTGCTAGTGGGTGGGATTTGGGG + Intronic
990599778 5:57346522-57346544 TTGGACCAGGGTGGGAGTGGTGG + Intergenic
993346169 5:86785794-86785816 TTGGTCTAGGGGAGAATATGAGG - Intergenic
993699873 5:91106134-91106156 TTTGTATAGGGTGAGAGTTGGGG + Intronic
994703953 5:103175761-103175783 TTGGACTAGGGTGGTAGCTGTGG + Intronic
995319747 5:110820302-110820324 TTGGTGTAAGGTGGGAGCTGTGG + Intergenic
997233509 5:132259540-132259562 TTGGGTTTGGGTGGGATCTGGGG + Intronic
998615419 5:143735216-143735238 TAGGTCTGGGGTGGGGTCTGAGG + Intergenic
999242035 5:150133319-150133341 TTGAGATAGGGTTGGATTTGGGG + Intronic
999302840 5:150501828-150501850 TGGGTCAAGAGTGTGATTTGGGG + Intronic
1000125729 5:158241942-158241964 TTGGTCTAGGGTGAGGCTTAGGG + Intergenic
1001449431 5:171812770-171812792 GTGGTCAATGGTTGGATTTGGGG + Intergenic
1002316786 5:178348948-178348970 TTGGGTTCAGGTGGGATTTGGGG - Intronic
1006516632 6:34549219-34549241 TTTGTCTGGAGTGGGATCTGGGG - Intronic
1007703723 6:43779028-43779050 TTGGTCTTGTGGGGGACTTGTGG + Intronic
1007745600 6:44041168-44041190 TTGGGGTGGGGTGGGATCTGTGG + Intergenic
1013460295 6:110368409-110368431 TTTGTTTAACGTGGGATTTGAGG - Intergenic
1014213228 6:118728660-118728682 TTGGACTAGGGTGGGAATGGTGG - Intergenic
1016183231 6:141172090-141172112 TTGGTCAGGGCTGGGAATTGAGG + Intergenic
1018442135 6:163823052-163823074 TTGGTCTCGGGTGGAAGGTGAGG + Intergenic
1019127470 6:169850510-169850532 GCGGTCAAGGATGGGATTTGGGG - Intergenic
1022284073 7:28938422-28938444 TTGGACTTGGATGGCATTTGAGG - Intergenic
1023330723 7:39113744-39113766 TTGGTCCAGGGTAGATTTTGTGG - Intronic
1024271613 7:47646601-47646623 CTGGTCTAGGGTGGGACCAGAGG + Intergenic
1024327605 7:48122738-48122760 TTGGTATAGGGTGAGAGATGAGG + Intergenic
1024577826 7:50779282-50779304 TTGGTCTTGGTTGGGACCTGAGG - Intronic
1026566972 7:71497125-71497147 TTTGTCTAGGGAGGGAGATGTGG + Intronic
1028840215 7:95421433-95421455 TTGGGCAAGGGTGGGAGTTTGGG - Intronic
1029031488 7:97472258-97472280 TAGGTCTTGGGTGGGGCTTGAGG - Intergenic
1035488314 7:159248800-159248822 TGGGGCTGGGGTGGGAGTTGAGG + Intergenic
1036592081 8:10177869-10177891 TTGATGTAGAGTGGGATTTTAGG + Intronic
1037380905 8:18284235-18284257 GAGGTTTAGGGTGGGCTTTGAGG - Intergenic
1037582951 8:20256477-20256499 ATAGTCTAGGGTGGTAGTTGTGG + Intronic
1040508315 8:48071565-48071587 TAGGTCTATGGTGGGACCTGAGG + Intergenic
1040533784 8:48288236-48288258 TGGGTCAAGGGTGAGATTTGGGG + Intergenic
1043099215 8:76018920-76018942 TTGGCCCAGGGTGTGATTTCAGG + Intergenic
1043107609 8:76134751-76134773 TTGGCCTAGGGTGGGCCCTGAGG - Intergenic
1046865591 8:119146657-119146679 TTGGTCTAAGGTGGTATGAGTGG - Intergenic
1047343995 8:124009723-124009745 CTGTTCTAGGGTGAGAGTTGAGG + Intronic
1051586872 9:18735963-18735985 CTAGTCTAGGGTGGAAGTTGAGG - Intronic
1052255539 9:26451999-26452021 TTGGTCTGGGATGAGATTTTTGG - Intergenic
1052368158 9:27636959-27636981 GTGGTCTAGGGTGGAATCAGAGG + Intergenic
1052453908 9:28669137-28669159 TTAGTCTAGGATGGGATCTTGGG - Intronic
1055017930 9:71639179-71639201 TAGGTCTTGGGTGGGGTCTGGGG - Intergenic
1055494416 9:76840691-76840713 TTGTTCTAGGCTGGGAGTGGTGG + Intronic
1057938259 9:99258485-99258507 CTGGTGAAGGGTGGGATTAGGGG - Intergenic
1058877772 9:109259169-109259191 TAGGTCTGGGGTGGGGTTTCAGG - Intronic
1059161448 9:112039076-112039098 TTGGACAAAGGTGGGCTTTGAGG + Intergenic
1061321536 9:129833805-129833827 TAGTGCAAGGGTGGGATTTGAGG + Intronic
1061388943 9:130306585-130306607 ATGGTGGGGGGTGGGATTTGGGG - Intronic
1186512526 X:10140656-10140678 TTACTCTAGTGTGGGATCTGGGG - Intronic
1189380478 X:40499330-40499352 TTGGGCTGGGGAGGGAATTGAGG - Intergenic
1189893190 X:45627158-45627180 TTGGTCTAGTGTGGGAGCCGAGG + Intergenic
1190334252 X:49252917-49252939 GTGGTTTAGGTTTGGATTTGCGG + Intronic
1190712228 X:53079229-53079251 TTGGGCTAGGGAGGGAGTTTAGG - Exonic
1191085386 X:56562157-56562179 TTGGTAGAGGGTGGGGGTTGGGG + Intergenic
1192343482 X:70282345-70282367 TGGGTCTGGGTTGGGCTTTGGGG + Intronic
1192361024 X:70439549-70439571 TTGGTCTTGGTTGGTATGTGTGG - Intergenic
1195501598 X:105607782-105607804 GTAGTCCAGGGTGGGTTTTGAGG + Intronic
1199872508 X:151912396-151912418 TTCGGCCAGGGTGGGAGTTGGGG - Intergenic
1201781330 Y:17725642-17725664 TAGGTCTGGGGTTGGATTAGAGG - Intergenic
1201820223 Y:18180348-18180370 TAGGTCTGGGGTTGGATTAGAGG + Intergenic