ID: 1162823175

View in Genome Browser
Species Human (GRCh38)
Location 19:13235664-13235686
Sequence GACGGAGAAGTTTGATGAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162823171_1162823175 6 Left 1162823171 19:13235635-13235657 CCAGAGAAGAATGCGGATGGTGT 0: 1
1: 0
2: 1
3: 16
4: 105
Right 1162823175 19:13235664-13235686 GACGGAGAAGTTTGATGAGCCGG 0: 1
1: 0
2: 1
3: 8
4: 90
1162823168_1162823175 28 Left 1162823168 19:13235613-13235635 CCTTGAAGGACTGCACAAAGGTC 0: 1
1: 3
2: 1
3: 8
4: 102
Right 1162823175 19:13235664-13235686 GACGGAGAAGTTTGATGAGCCGG 0: 1
1: 0
2: 1
3: 8
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162823175 Original CRISPR GACGGAGAAGTTTGATGAGC CGG Exonic
903260112 1:22127084-22127106 AAGGGAGGAGTTTGATGAGTGGG + Intronic
907766674 1:57419771-57419793 CACAGAGAAGTTAGATTAGCTGG + Intronic
909435950 1:75642687-75642709 GAAGGAGAAGTATGAGGAGGAGG + Intergenic
910495922 1:87826945-87826967 TATGGAGCAGTTTGATAAGCTGG + Intergenic
912174312 1:107139150-107139172 GGGGGAGAAGTTTGTTGAGTTGG - Intergenic
912649524 1:111425449-111425471 GAGAGAGAGGGTTGATGAGCTGG + Intronic
916478808 1:165196334-165196356 GACAGAGAAGTTTGTTGAGATGG + Intergenic
920976638 1:210792036-210792058 CATGGGGAAGATTGATGAGCAGG - Intronic
922133407 1:222801382-222801404 CACGAAGGAGTTTGATGAGGAGG + Intergenic
1063370427 10:5518351-5518373 GAGGAAGGAATTTGATGAGCAGG + Intergenic
1068708333 10:60102570-60102592 GAAAGAGAAGTTTAAGGAGCAGG - Intronic
1070270517 10:74950058-74950080 CACAGAGAAGTATAATGAGCAGG + Intronic
1080546448 11:33323616-33323638 GATGGAGAAGTTTGAGGAAGTGG + Intronic
1090541460 11:127711040-127711062 GAGGCAGAAGTGAGATGAGCTGG + Intergenic
1097241241 12:57576675-57576697 AAGGAAGAAGTTTGAAGAGCTGG + Intronic
1104705795 12:130946549-130946571 GAAGGAGATCTTTGATGATCTGG + Intergenic
1111792051 13:92869943-92869965 GAATGAGAACTTTGTTGAGCAGG + Intronic
1113671433 13:112178215-112178237 GATGGACAAGGTGGATGAGCTGG - Intergenic
1115009290 14:28524718-28524740 GAAGGGGAAGTATGATGAGCAGG + Intergenic
1115448493 14:33519239-33519261 TACTGAGAAGTTTGATGAGAAGG - Intronic
1116484924 14:45436317-45436339 CAGGGAGAAATTTAATGAGCTGG - Intergenic
1119372351 14:74157719-74157741 GACATAGAACTTTGATAAGCAGG - Intronic
1120293581 14:82609512-82609534 GACTGAGAAGTTCAATTAGCTGG - Intergenic
1120585097 14:86302688-86302710 GACAGAGAAGTTTCATGCGTTGG + Intergenic
1121790822 14:96698445-96698467 GAAGGAGGAATTTGATGAGGGGG - Intergenic
1122301093 14:100731563-100731585 GATGGAAAAGTATGAAGAGCTGG + Intronic
1123468806 15:20535122-20535144 GGAGGAGAAGATTCATGAGCAGG - Exonic
1126368950 15:47925704-47925726 GATGGATAAATTAGATGAGCGGG - Intergenic
1126475833 15:49064065-49064087 GAAGGAGAAACTTGATGGGCCGG - Intergenic
1139644365 16:68317364-68317386 GAAGGTGAAGTTTGAGCAGCAGG + Intronic
1139934269 16:70556960-70556982 GACTGAGAAGCAGGATGAGCTGG + Exonic
1142705622 17:1692019-1692041 GAGAGAGAAGCTTGATGAGTTGG + Intergenic
1143628759 17:8125398-8125420 GACGGAGAGGTGGGATGTGCTGG - Intergenic
1146167396 17:30600667-30600689 GAAGGAGAAGTGGGAGGAGCGGG + Intergenic
1151219592 17:72602667-72602689 GACAGAGAAGTTTGGTGAAAGGG + Intergenic
1159828272 18:73241945-73241967 GAGGGAAAAGTTTTAAGAGCTGG + Intronic
1160343914 18:78113738-78113760 GGTGGAGAAGTCCGATGAGCTGG + Intergenic
1161527993 19:4769295-4769317 GACGGCGAAGTTTGACGGTCTGG + Intergenic
1161980649 19:7628523-7628545 GACTGAGAAGTCTGATGATTTGG - Intronic
1162823175 19:13235664-13235686 GACGGAGAAGTTTGATGAGCCGG + Exonic
1164592619 19:29514531-29514553 GAAGGAGAGGTGTGATGAGGAGG + Intergenic
1168441308 19:56369565-56369587 AAGGGAGAAGATGGATGAGCTGG + Intergenic
929794170 2:45046329-45046351 GAGGGAGAAGTTTCAGGAGGAGG + Intergenic
929942681 2:46346936-46346958 GACGGAGGTGTTCTATGAGCTGG + Exonic
930329012 2:49958881-49958903 GACGGAGAACTTTGATTATCTGG - Intronic
930550326 2:52826568-52826590 GATAGAGAAGGTTGATGAGGAGG + Intergenic
937048735 2:118870528-118870550 TACGGAAAAGTTTCATAAGCTGG - Intergenic
937899851 2:127011563-127011585 GAAGGAGAAGTTTTAGGAGGTGG + Intergenic
939740167 2:145896664-145896686 AAGGAAGAAGTTAGATGAGCAGG + Intergenic
1170579014 20:17684035-17684057 GGTGGAGAAGTGGGATGAGCAGG + Intergenic
1173317091 20:41954830-41954852 GACAGAGAAGTCCGTTGAGCTGG - Intergenic
1173905869 20:46628324-46628346 GAGGGAGAATCTTGCTGAGCGGG + Intronic
1178949542 21:36974904-36974926 GACGGAGAACTTGGATGTGCTGG - Intronic
1182328395 22:29531731-29531753 GACTGAGAAATTTCCTGAGCAGG + Intronic
949110849 3:258603-258625 GACGGAAAAGTTGAAGGAGCTGG - Intronic
950093651 3:10315374-10315396 GACGGACCTGTCTGATGAGCAGG + Exonic
950949915 3:16987287-16987309 GCAGGAGAGGTTTGAAGAGCAGG + Intronic
951418528 3:22455360-22455382 CACGCAGCAGTTTGATCAGCTGG + Intergenic
954300754 3:49699629-49699651 GAGGGAGAAGTGTGAGGGGCAGG - Intronic
954442038 3:50527219-50527241 GAGGGAGCAGCTTGATGAGTGGG - Intergenic
958153166 3:89718379-89718401 GCAGGAGAAGATTGATGACCTGG - Intergenic
959068423 3:101680262-101680284 CCCGGAGTAGTTTGTTGAGCTGG - Intergenic
962592956 3:136909307-136909329 TACGTAGAAGTTTGCTGAGAGGG + Intronic
966557222 3:181276262-181276284 GAAGGAGAAGATGCATGAGCAGG + Intergenic
966877837 3:184333519-184333541 GACAGAGAAATTTGAGGAGAGGG + Intronic
967946511 3:194808345-194808367 GGCAGAGAAGTCTGATGAGGAGG + Intergenic
968939681 4:3631349-3631371 GCAGCAGATGTTTGATGAGCCGG + Intergenic
971985703 4:33820600-33820622 GAAAGAGATGTTTGCTGAGCAGG - Intergenic
978666818 4:111194101-111194123 GAAGGGGAAGATTGATGAGTAGG + Intergenic
984093531 4:175406019-175406041 GAGGGAGATTTTTAATGAGCAGG + Intergenic
986676444 5:10189634-10189656 TAAGGAGAAGTTTGATGATGTGG - Intergenic
990936094 5:61151064-61151086 GAGGGAGAAGTTTCATTAGATGG + Intronic
999241137 5:150128065-150128087 GACCGAGATGTGTGATGAGCGGG - Intronic
1002449675 5:179311507-179311529 GAAGGAGAAGGTTCAGGAGCTGG - Intronic
1005575844 6:27188526-27188548 GAAGGAGGAGTTTGATAATCAGG + Intergenic
1007287669 6:40759332-40759354 CACCGAGAAGGTTAATGAGCTGG + Intergenic
1009865611 6:69394064-69394086 GATGGAGAGGTTTTAAGAGCTGG + Intergenic
1010720377 6:79276743-79276765 GATAGTGAAGTCTGATGAGCTGG + Intergenic
1017718910 6:157231363-157231385 GAAGGAGAAGATTCAGGAGCTGG - Intergenic
1023357065 7:39377932-39377954 GAAGGAAAAGTTTGAGGAGAAGG - Intronic
1024332580 7:48170912-48170934 GAAGGAGAAGTATGAAGTGCAGG + Intergenic
1032896011 7:136251531-136251553 GAAGGAGAAATTAGATGTGCAGG + Intergenic
1033528793 7:142243320-142243342 GACGGAGAAGTTTGAGGAGGTGG - Intergenic
1033832576 7:145271419-145271441 GAAGGAGAAGGTGGAGGAGCAGG + Intergenic
1041185420 8:55295269-55295291 GACGGAAAAGTATTATGAGAAGG + Intronic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1044204763 8:89480110-89480132 GACAGAGAGGTTTGGTGAGCTGG + Intergenic
1044217571 8:89629973-89629995 GAATGAGTATTTTGATGAGCTGG - Intergenic
1048351611 8:133621056-133621078 GATGGAAAAGATTGCTGAGCTGG - Intergenic
1051326953 9:15982470-15982492 GATGGAGTAGTTTGATGATGAGG + Intronic
1059636151 9:116172676-116172698 AACAGAGAAGATTGATGAGGAGG - Intronic
1060096180 9:120792944-120792966 GACGATGAAGTGTGATGAGGTGG - Intronic
1061004046 9:127918369-127918391 GACTGGGAAGGTTGCTGAGCTGG - Intergenic
1061756079 9:132813385-132813407 GATGGAGCAGGTTGATGAGGAGG - Intronic
1062354537 9:136155533-136155555 AACGGAGCAGTTTGAGGAGCAGG - Intergenic
1185566624 X:1099807-1099829 GATGGAGAAGTTAGAGGAGGAGG + Intergenic
1185862275 X:3590856-3590878 GACGGAGAAGAGTGGTGTGCTGG - Intergenic
1186432332 X:9515525-9515547 GACGGGGATGTTCGATGATCTGG - Intronic
1196187795 X:112762961-112762983 GAAGGAGAAGTTGGATGATTTGG + Intergenic
1196820664 X:119697864-119697886 GAAGGAGAAGTTTGAAGGCCGGG + Intergenic