ID: 1162827789

View in Genome Browser
Species Human (GRCh38)
Location 19:13264291-13264313
Sequence AAGGTGACCCACTGGGGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 213}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162827789_1162827798 5 Left 1162827789 19:13264291-13264313 CCCCATCCCCAGTGGGTCACCTT 0: 1
1: 0
2: 0
3: 26
4: 213
Right 1162827798 19:13264319-13264341 ACATCCCGCCATCCATTCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 86
1162827789_1162827797 4 Left 1162827789 19:13264291-13264313 CCCCATCCCCAGTGGGTCACCTT 0: 1
1: 0
2: 0
3: 26
4: 213
Right 1162827797 19:13264318-13264340 AACATCCCGCCATCCATTCCTGG 0: 1
1: 0
2: 0
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162827789 Original CRISPR AAGGTGACCCACTGGGGATG GGG (reversed) Intronic
900794615 1:4700533-4700555 GAGCTGACCCCCAGGGGATGAGG + Intronic
902764782 1:18606981-18607003 GCGGTGCCCCTCTGGGGATGGGG - Intergenic
902836805 1:19052817-19052839 AAGGTGACCCGGTGGGGAGGAGG - Intergenic
903071886 1:20730796-20730818 AAGGGGACACACTTGGAATGAGG + Intronic
903575417 1:24336811-24336833 AAGATGACCCACAGGAGGTGAGG + Exonic
903743369 1:25571261-25571283 AAGGGCAGCCACTGGGGAAGAGG - Intergenic
904306374 1:29592786-29592808 AGGGTGACCCACAGGGGCTCTGG + Intergenic
907076443 1:51583452-51583474 AAGGTCACCCACTGAGCAAGTGG + Intronic
908867435 1:68566122-68566144 ATGCAGACCCACTGTGGATGCGG - Intergenic
910281256 1:85503915-85503937 GAGGTGAATCACAGGGGATGCGG + Intronic
910936013 1:92485069-92485091 AAGGGGACACAATGGGGCTGGGG - Intronic
912553618 1:110500306-110500328 AAGGGCACCCCCTGAGGATGAGG - Intergenic
913077626 1:115354257-115354279 AAGGGGACCCAACAGGGATGGGG - Intergenic
913530328 1:119729464-119729486 AAGAGGACCCCCTGGGGAAGGGG - Intronic
914742808 1:150479366-150479388 AAGGGGACACAATGGGGATGAGG - Intergenic
919055007 1:192559636-192559658 AAGTTGAGTCACTGCGGATGTGG + Intergenic
920403648 1:205693233-205693255 AAGATGACCCAAGGGGGAAGAGG + Intergenic
920442550 1:205990599-205990621 AAGGTGACCCCCATGGGGTGGGG + Intronic
920500631 1:206482911-206482933 AAGGTGGGCCACTTGGCATGAGG - Intronic
921169306 1:212532262-212532284 AAGGAGATCCACTGAGGCTGAGG - Intergenic
922244049 1:223777526-223777548 CAGTGGAGCCACTGGGGATGTGG - Intergenic
923270996 1:232354830-232354852 CAGGTCACCCACTTGGCATGCGG - Intergenic
1064140920 10:12789634-12789656 AACGTTACCCAGTGGGAATGTGG - Intronic
1064803890 10:19109190-19109212 AAGCTTCCCCACTGGGGGTGGGG + Intronic
1068747659 10:60553245-60553267 AAGGTTACCCAGTGGGTATAAGG - Intronic
1069753227 10:70758089-70758111 GAGGTGAGCCAGAGGGGATGGGG + Exonic
1070568339 10:77620658-77620680 GAGAGAACCCACTGGGGATGTGG - Intronic
1070975322 10:80601884-80601906 AAGGTGACTCACTAGGGCTGGGG + Intronic
1071342818 10:84664341-84664363 ATGGTGTCACAGTGGGGATGGGG + Intergenic
1072617456 10:97059309-97059331 AGGATGACCCACTGAGGCTGGGG + Intronic
1072938549 10:99736484-99736506 AATGTGACCCACTTGGGGAGAGG - Intronic
1074211558 10:111340037-111340059 ACGGTAATCCACTGGGAATGCGG - Intergenic
1076655671 10:132021943-132021965 AAAGGGACCCACAGGGGACGGGG - Intergenic
1077295540 11:1824776-1824798 AAGGTGACCCTCTGGGTTGGGGG + Intergenic
1077830227 11:5860170-5860192 AAGATGACACACTGAGGACGTGG - Intronic
1078355240 11:10627874-10627896 TTCGTGACCCACTGGAGATGAGG - Intronic
1080108682 11:28540887-28540909 AGTGTGACTCAGTGGGGATGGGG - Intergenic
1082795815 11:57377038-57377060 AATGTGAGCCAGTAGGGATGTGG - Intronic
1083039623 11:59673013-59673035 AATGTGAAACTCTGGGGATGGGG - Intergenic
1083297941 11:61725331-61725353 AGCCAGACCCACTGGGGATGGGG + Intronic
1083326149 11:61873961-61873983 AAGGGAACCCACAGGGAATGGGG - Intronic
1083392054 11:62359207-62359229 GATGTGATCCACTGTGGATGTGG - Intronic
1083776802 11:64897986-64898008 GAGGTCACAGACTGGGGATGGGG + Intronic
1084552153 11:69851061-69851083 AAGGTGATCAGCTGAGGATGAGG + Intergenic
1085291012 11:75399575-75399597 AAGGTGAGCCTCTGGGGACTGGG + Exonic
1085533256 11:77203809-77203831 AGGGTGAACCACTGGGCAGGGGG + Intronic
1086556359 11:88116009-88116031 AAGTTGCCCAACAGGGGATGGGG - Intronic
1088734698 11:112719093-112719115 AAGGATACTCACTGGGGAGGTGG + Intergenic
1088868535 11:113871952-113871974 AAGGTCACCCAGTGAGGATATGG - Intronic
1089502092 11:118938628-118938650 GAGATGACTCACTGGGGCTGGGG + Intronic
1091260388 11:134229493-134229515 AAGGAGACGCAGTGGGGCTGTGG - Intronic
1091801705 12:3328660-3328682 CAGGTGCCGCACTGGAGATGGGG - Intergenic
1092041487 12:5389082-5389104 TAGATGACCCATTAGGGATGAGG + Intergenic
1094767547 12:33614738-33614760 AAGGTGACCCAATGTGGGGGTGG - Intergenic
1095295578 12:40523664-40523686 AAGGTGACCTACTGGGAAGGAGG - Intronic
1098369827 12:69746094-69746116 AAGGTCATGCACTGGGAATGAGG - Intronic
1099315356 12:81077414-81077436 AAGGTGACCCCACTGGGATGCGG - Exonic
1100790213 12:98122020-98122042 AAGATGTCTCACTGGGGAAGGGG + Intergenic
1101380203 12:104207781-104207803 AGGGTGGCCCACAGGTGATGTGG + Intergenic
1101641326 12:106587293-106587315 ATGGTGACGCGCTGGGGACGGGG - Intronic
1102919325 12:116779974-116779996 AAGGTGACCCAAAGGGAATCTGG + Intronic
1104847200 12:131852552-131852574 AACGTGACTCAGTGAGGATGAGG + Intergenic
1104973111 12:132540396-132540418 AGGGTGGCCCACAGGGAATGGGG - Intronic
1107729499 13:43334082-43334104 AAGGTGAAACTCTAGGGATGGGG + Intronic
1109103712 13:58221486-58221508 AAGATTAGCCACTGGGGAAGGGG - Intergenic
1109659912 13:65443956-65443978 AAGCAGACACAATGGGGATGAGG + Intergenic
1117633112 14:57713908-57713930 AAGCTGACCCATGGGGGGTGGGG - Intronic
1117920240 14:60721538-60721560 AGGGTGACTCACCGGGGGTGCGG + Intronic
1118594540 14:67425618-67425640 CAGGTGAACCAGTTGGGATGAGG + Intergenic
1119313823 14:73674365-73674387 AAGGTGACCCAATCACGATGTGG + Intronic
1119313831 14:73674433-73674455 AAGGTGACCCAATCACGATGTGG + Intronic
1119908561 14:78328107-78328129 AAGCCGACACACAGGGGATGGGG + Intronic
1122318963 14:100841862-100841884 AAGGTGAGCCACGGGGGTTGGGG - Intergenic
1202848450 14_GL000225v1_random:1111-1133 AAGGTGACCCACGAGGGAGCAGG - Intergenic
1202849657 14_GL000225v1_random:8902-8924 AAGGTGACACACGAGGGATCAGG - Intergenic
1202859538 14_GL000225v1_random:72691-72713 AAGGCGACCCACGAGGGAGGAGG + Intergenic
1123812751 15:23945315-23945337 ATGATGACCCACTGCAGATGTGG - Intergenic
1124232482 15:27957307-27957329 AAGGAGTGGCACTGGGGATGGGG - Intronic
1125109598 15:36015380-36015402 AAGGTGACCCAAGTGGGTTGCGG - Intergenic
1126067813 15:44839340-44839362 CAGGTGACCCAGTGGGACTGTGG + Intergenic
1126092017 15:45061235-45061257 CAGGTGACCCAGTGGGACTGTGG - Intronic
1127285083 15:57525423-57525445 AAGGTGACCCAGTTGGCAAGAGG - Intronic
1128082798 15:64866242-64866264 AATGTAAACTACTGGGGATGGGG - Exonic
1129226589 15:74174017-74174039 AAGGTAAGCCAGTGGGGAGGAGG + Exonic
1129256282 15:74335870-74335892 CAGGTCACCCCCTGGGAATGGGG + Intronic
1129932322 15:79422078-79422100 GAGGTGAGACACTGGGGATGGGG - Intronic
1132009710 15:98265492-98265514 AAGTTGCCCGACTGTGGATGGGG + Intergenic
1132501034 16:284790-284812 CAGGTGAGCCACTGGGCATGGGG + Exonic
1132762697 16:1518655-1518677 AGCGTGACCCAGAGGGGATGTGG + Intronic
1133040450 16:3057661-3057683 CCAGTGACCCACTGGGGCTGTGG + Intronic
1135526352 16:23216202-23216224 AAGGTGACACAGTGAGGAGGTGG + Exonic
1135888518 16:26335807-26335829 AATTTGACCCTCTGGGGCTGGGG - Intergenic
1136411117 16:30077818-30077840 GAGGTCACCCACTGAGGACGTGG + Intronic
1138093234 16:54193613-54193635 AACGAGACCCACTGGCAATGAGG - Intergenic
1140262835 16:73395495-73395517 AGGGTGACCCTCTTGGCATGGGG - Intergenic
1140649223 16:77068321-77068343 AAGATGACCCACTGGAGAGAAGG - Intergenic
1140863695 16:79041305-79041327 AAGGTGACACACAGAGGCTGGGG - Intronic
1143101340 17:4506378-4506400 ATCGTGACCCACAGGGGGTGTGG - Intronic
1143296633 17:5876260-5876282 CAGGTGGGACACTGGGGATGGGG + Intronic
1144789572 17:17849934-17849956 AAGCTGACCTTCTGGGGAGGAGG + Intronic
1148834988 17:50461285-50461307 AAGGTGACCGGCTGGGCATGTGG + Exonic
1149467608 17:56892103-56892125 TATGTGAACCTCTGGGGATGCGG + Exonic
1151826351 17:76526677-76526699 AAGGTGAGACACAGGGGATGGGG + Intergenic
1152643097 17:81457325-81457347 GAGGTGACCCTCTGGGCATGCGG - Intronic
1154268378 18:12898351-12898373 AAGGTAAAGCACTGGGCATGTGG + Intronic
1155512243 18:26589716-26589738 AGGTTGACCCACTGGGGCTAGGG - Intronic
1155863334 18:30932308-30932330 AAGTGGACCCTCTAGGGATGAGG + Intergenic
1155924015 18:31634327-31634349 AAGATGAGCAACTGGGAATGTGG + Intronic
1156466936 18:37353650-37353672 AAGGTGGGGGACTGGGGATGAGG + Intronic
1157347270 18:46850850-46850872 AAGGTGACCAGCTGTTGATGTGG - Intronic
1157856071 18:51106892-51106914 AAGGTGACCTCCTGGGAGTGAGG - Intergenic
1160933571 19:1582456-1582478 GAGGGGACCCAGTGGGGTTGGGG - Intronic
1162827789 19:13264291-13264313 AAGGTGACCCACTGGGGATGGGG - Intronic
1164885765 19:31777215-31777237 CAGGTGACTCAGTGGGCATGGGG + Intergenic
1166192903 19:41187358-41187380 AAGGCTACCCACTGGGGAATGGG - Intergenic
1167242268 19:48351418-48351440 TGGGGAACCCACTGGGGATGGGG - Intronic
1167372630 19:49092732-49092754 AAGAAGACCCACAGTGGATGTGG - Intronic
925905947 2:8539766-8539788 GGGGTGTCCCACTGGGGTTGGGG - Intergenic
926738391 2:16091386-16091408 AAGGTGAGCCGCAGGGGCTGTGG + Intergenic
927232801 2:20841999-20842021 GGGGTGACCCATTTGGGATGAGG + Intergenic
927419584 2:22916227-22916249 AAGGCCACTCCCTGGGGATGTGG - Intergenic
929411323 2:41700065-41700087 AACGAGACCTCCTGGGGATGAGG - Intergenic
929755540 2:44761104-44761126 GAGGTGGCCAACTGGGGAGGAGG + Intronic
931321975 2:61180627-61180649 ACTGGGACCCACTGGGGAGGAGG + Intronic
931990413 2:67784418-67784440 AATGTGACCCAATGAGGAGGAGG + Intergenic
932271505 2:70413947-70413969 AGGATGACCCACTGGGGAGCAGG + Intergenic
932469515 2:71944712-71944734 AAGCTGACCCTTAGGGGATGAGG - Intergenic
933384225 2:81589669-81589691 AAAGTGACTTAGTGGGGATGAGG - Intergenic
935182861 2:100705844-100705866 AAGAAGCCCCACTGGGGTTGGGG - Intergenic
935315454 2:101829285-101829307 AACCTAACCCACTGGGAATGTGG + Intronic
936239164 2:110772352-110772374 CAGGTGACCCACTGTGCATCTGG + Intronic
937692270 2:124769805-124769827 AAGCTGACCCAGTGTGGGTGGGG - Intronic
937839025 2:126507012-126507034 GAGGTGACCCCCTGGAGGTGAGG - Intergenic
938289222 2:130140632-130140654 AAGATGCCCCACTGGGTGTGGGG - Intronic
938467304 2:131532306-131532328 AAGATGCCCCACTGGGTGTGGGG + Intronic
939723165 2:145680393-145680415 AAGGTGTCCCAGTGGAGAAGAGG - Intergenic
941878571 2:170459716-170459738 ATGGGAACCCACTGGGGGTGGGG + Intronic
943172026 2:184414092-184414114 ATGATGAACCACTGGGGATTAGG + Intergenic
946237504 2:218333026-218333048 AATGTCACCCTCTGGGGACGAGG + Intronic
946819471 2:223615237-223615259 AACGTGACCCACAGGGTATGTGG + Intergenic
947082442 2:226413501-226413523 AAGGTGACACAATGGGCACGTGG + Intergenic
1169336882 20:4763960-4763982 AACTTGTCCCACTGTGGATGAGG - Intergenic
1169765083 20:9140266-9140288 AAGGAGACGGACAGGGGATGTGG - Intronic
1171406451 20:24915158-24915180 AGGGTGAGCCACTGGACATGTGG + Intergenic
1172294391 20:33798347-33798369 AAGGTGAGATTCTGGGGATGAGG + Intergenic
1173061716 20:39668516-39668538 AAGGTCACCCACTGGGCAAGAGG + Intergenic
1173137980 20:40457360-40457382 AAGGGGAGGCACTGGGGAAGGGG - Intergenic
1173172773 20:40741035-40741057 AAGGTGACACAGTGGGTAGGGGG + Intergenic
1173252938 20:41374225-41374247 AAGATTACCCACTGGTGATGGGG + Intergenic
1174453801 20:50636010-50636032 AAGGGGGCCCACAGGGGCTGGGG - Intronic
1174593579 20:51666160-51666182 AAGATGACCCACTGGGGTACAGG - Intronic
1175342361 20:58241779-58241801 ATGGTGTCCCACTGGGGTTTGGG - Intergenic
1175515744 20:59568736-59568758 CAGGTGACCCTCTGGGGCTAGGG - Intergenic
1175952912 20:62592811-62592833 GTGGTCACCCACTGGGGCTGGGG + Intergenic
1178644401 21:34373611-34373633 AAGGTAACTGAGTGGGGATGGGG - Intergenic
1179634359 21:42697813-42697835 AATCTTACCCACTGGGGATGAGG + Intronic
1181089076 22:20459743-20459765 CAGGTCTCCCACTGTGGATGGGG + Intronic
1181457558 22:23068316-23068338 GAGGAGACCCACTGGGGCTCTGG - Intronic
1183064291 22:35352848-35352870 ACTCTGACCCACTGGGGATTTGG - Intergenic
1183686123 22:39362368-39362390 GAAGTGACCCACTGGGGATTAGG - Intronic
1183990678 22:41595285-41595307 AAGGTGGCCCACTGGGCAGGAGG + Intergenic
1184671642 22:46014923-46014945 AGGGTGACCCGGTGGAGATGTGG - Intergenic
950158757 3:10743413-10743435 AAGGTCACCCAGTGGTGAGGCGG + Intergenic
950480746 3:13242313-13242335 AAGGTGACCCACATGAGGTGCGG + Intergenic
954616880 3:51973719-51973741 AAGGCGACCCGCCGGGGATGCGG + Intronic
954692203 3:52401652-52401674 AGGGTGTCCCAGTGGGGTTGGGG - Exonic
955837148 3:63068617-63068639 AAGAGCATCCACTGGGGATGGGG + Intergenic
956027157 3:64995427-64995449 AAGGATACCGACTGGAGATGAGG + Intergenic
956046990 3:65206407-65206429 AAGGTGTCTCTCTGGGGCTGGGG + Intergenic
956458951 3:69452395-69452417 AAGGTCACCCACTCGGTAAGTGG - Intronic
962243878 3:133775369-133775391 AAGGTGCCCCGCTGGGGAGATGG - Intronic
963114383 3:141713926-141713948 TACTTGGCCCACTGGGGATGTGG - Intergenic
968321150 3:197769814-197769836 CAGGGGACCCACAGGTGATGGGG - Intronic
968713333 4:2136782-2136804 AAGGTGCCAAACTGGGGAGGTGG + Intronic
969565828 4:7977463-7977485 ATGGTGGCCCACTGGGAATGTGG - Intronic
971250283 4:24968597-24968619 ACCATGACCCACTGGGAATGAGG - Intronic
974100603 4:57411880-57411902 AAGGAGACTAATTGGGGATGGGG - Intergenic
976145983 4:82043506-82043528 AATGAGATACACTGGGGATGAGG - Intronic
981688257 4:147479580-147479602 AAGGTGACCCTTTGGGCATGTGG - Intergenic
985791935 5:1933525-1933547 AAATTGTCCCACAGGGGATGAGG - Intergenic
986887887 5:12262491-12262513 AAGGAGACCCTTTGGGGAAGGGG - Intergenic
987118604 5:14745921-14745943 CATGTGACCCACAGGGTATGTGG + Exonic
989118235 5:37977559-37977581 AAGGTCAGCCCCTTGGGATGGGG - Intergenic
989204170 5:38795228-38795250 GAGGTGACCAACTGGGACTGGGG + Intergenic
990211222 5:53482779-53482801 AAGGAGACCCGGCGGGGATGGGG - Intronic
992175328 5:74144052-74144074 AAGGTCACCAACTGAGGGTGAGG + Intergenic
995834154 5:116383781-116383803 AAGGTGATACTCTGGGGAGGGGG - Intronic
996108286 5:119533343-119533365 AAGGTGAAATACTGGGGTTGAGG + Intronic
999569774 5:152906551-152906573 AAGGTGACCCAGTAAGGAAGTGG + Intergenic
1000019610 5:157307863-157307885 AAGGTCAGCAACTGGGGCTGGGG + Exonic
1000532823 5:162444719-162444741 AAGGTGTCCCCCTGGAGTTGGGG - Intergenic
1000921905 5:167148168-167148190 AGGGTGAGCCACAGGGGTTGTGG - Intergenic
1001301285 5:170535591-170535613 AAGGGGAACAACTGGGGGTGGGG - Intronic
1001812823 5:174642913-174642935 GCTGTGACCCACTAGGGATGGGG - Intergenic
1002418695 5:179134548-179134570 GAGGTGACCCAGTGAGGACGTGG - Intronic
1003053382 6:2799022-2799044 AAGGTACCCCAATGGGTATGAGG - Intergenic
1006116262 6:31777552-31777574 ATGGTGAGCCGCTGGGGGTGAGG + Exonic
1007432181 6:41783046-41783068 AAGGAGGCTCACTGGGGCTGTGG + Intronic
1018715640 6:166530498-166530520 AAACTGACCCCCTGGGGAGGAGG - Intronic
1019540891 7:1550533-1550555 AGGCTGCCCCGCTGGGGATGGGG - Intronic
1020237784 7:6369893-6369915 ATGGTTTCCCACTGGGGAGGAGG - Intergenic
1020719731 7:11726836-11726858 CATGAGACCCACTAGGGATGCGG - Intronic
1021837871 7:24698250-24698272 GATCTGAGCCACTGGGGATGAGG - Intergenic
1022508838 7:30922646-30922668 TAGGAGACCCACGGGGGGTGGGG + Intronic
1024587019 7:50850511-50850533 GATGTAACCCACTGGGGATTTGG + Intergenic
1024978825 7:55139224-55139246 AAGGTCACCCAATGAGGAAGTGG + Intronic
1025256357 7:57386121-57386143 CAGGTGAAGCACTGGCGATGTGG + Intergenic
1027164950 7:75827745-75827767 AGGGTGACCTGCTGGGGAGGTGG + Intergenic
1028039370 7:86029617-86029639 AAGAAAACCCACTGGGGATAGGG + Intergenic
1028450618 7:90977982-90978004 AGGGTGAGACACTGGGGCTGGGG + Intronic
1029687370 7:102158015-102158037 AAGGTGGCCAACTGGAGGTGAGG - Intronic
1030077850 7:105751803-105751825 CAGGTGTCCCCCTGGGGATGTGG + Intronic
1030306684 7:108026178-108026200 AAGGGAACCCACTGAGGCTGTGG - Intronic
1030507722 7:110445656-110445678 AACGTGACCCACTTAGGATCTGG - Intergenic
1032115595 7:129114375-129114397 AAGGTGTCTTGCTGGGGATGGGG - Intergenic
1032396934 7:131597213-131597235 AAGCTCACACTCTGGGGATGTGG - Intergenic
1033276497 7:139975633-139975655 AAGGTGAACCAATGAAGATGCGG - Intronic
1035260776 7:157660216-157660238 AATGTGACCCTCTGGGGAAGAGG + Intronic
1035478927 7:159165983-159166005 ACAGTGACCCTCTGGGGCTGGGG + Intergenic
1040789222 8:51205711-51205733 AAGGTGCTCCAGTGGGGCTGTGG + Intergenic
1041213646 8:55578431-55578453 TATGTGACCAACTGGGGAGGGGG + Intergenic
1042955074 8:74241169-74241191 AAGGTGACTCAGTGAAGATGAGG + Intronic
1046638787 8:116702695-116702717 AAGCTGATTCACTGGGGAGGGGG + Intronic
1046758685 8:117997860-117997882 AGGGTGATTCACTGGGGATGAGG - Intronic
1047496985 8:125415521-125415543 GAGCTGACCCACTGGAGATGAGG + Intergenic
1048425478 8:134319383-134319405 AAGGGGACCCACTGAGGGTGAGG - Intergenic
1051166590 9:14268479-14268501 AAGGTAAGTCATTGGGGATGGGG - Intronic
1054916371 9:70498579-70498601 AAGGTCAGGCACTTGGGATGTGG - Intergenic
1057439956 9:95075926-95075948 AAGCTGCCCCGATGGGGATGGGG + Intronic
1058513235 9:105742038-105742060 CAGGAGACCCACTGGGGATTTGG + Intronic
1060756360 9:126217327-126217349 AAGGTGGGCCACTGGGGGTGGGG + Intergenic
1061822592 9:133236786-133236808 CAGGGGACCCAGTTGGGATGAGG + Intergenic
1062209134 9:135353758-135353780 AAGGTGACCCAAAGGAGAGGGGG + Intergenic
1185527495 X:791002-791024 AATGTGACACACGGGAGATGTGG + Intergenic
1189390215 X:40570293-40570315 TAGGTGTGGCACTGGGGATGGGG - Intergenic
1189637409 X:43025840-43025862 AAGATGACACACTGGGCCTGAGG + Intergenic
1190765709 X:53473815-53473837 CAGGTGACCCACTGGGTGAGAGG - Intergenic
1194239289 X:91423857-91423879 AGGGTGTCCTACTGTGGATGAGG + Intergenic
1195702113 X:107713420-107713442 ATGGTGTCCTACTGTGGATGAGG - Exonic
1195934317 X:110110661-110110683 AATCAGACCCTCTGGGGATGGGG - Intronic