ID: 1162828761

View in Genome Browser
Species Human (GRCh38)
Location 19:13270910-13270932
Sequence TAGATCATGCAGGAACTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162828761_1162828768 3 Left 1162828761 19:13270910-13270932 CCTCCCAGTTCCTGCATGATCTA 0: 1
1: 0
2: 1
3: 18
4: 155
Right 1162828768 19:13270936-13270958 GCCTGCCAGGGTTGACAGGATGG 0: 1
1: 0
2: 2
3: 34
4: 231
1162828761_1162828765 -10 Left 1162828761 19:13270910-13270932 CCTCCCAGTTCCTGCATGATCTA 0: 1
1: 0
2: 1
3: 18
4: 155
Right 1162828765 19:13270923-13270945 GCATGATCTACAAGCCTGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 88
1162828761_1162828766 -9 Left 1162828761 19:13270910-13270932 CCTCCCAGTTCCTGCATGATCTA 0: 1
1: 0
2: 1
3: 18
4: 155
Right 1162828766 19:13270924-13270946 CATGATCTACAAGCCTGCCAGGG 0: 1
1: 0
2: 0
3: 5
4: 91
1162828761_1162828767 -1 Left 1162828761 19:13270910-13270932 CCTCCCAGTTCCTGCATGATCTA 0: 1
1: 0
2: 1
3: 18
4: 155
Right 1162828767 19:13270932-13270954 ACAAGCCTGCCAGGGTTGACAGG 0: 1
1: 0
2: 1
3: 11
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162828761 Original CRISPR TAGATCATGCAGGAACTGGG AGG (reversed) Intronic
900816462 1:4850771-4850793 CACAACATGCAGGAAGTGGGTGG - Intergenic
901683676 1:10931343-10931365 CAGATCTTGCATGAACTGAGAGG - Intergenic
901691502 1:10976292-10976314 TAGATGAGGCAGCAGCTGGGCGG - Intronic
903254170 1:22081556-22081578 TAGCTCATGCAAGGACTGGTTGG + Intronic
904922469 1:34019770-34019792 TAGCTCATGTAGGACCTAGGAGG - Intronic
905341538 1:37281797-37281819 CAGATTATGCAGGGCCTGGGAGG - Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
907496599 1:54849483-54849505 AAGAACATGCAGGAACTGACAGG - Intergenic
912797830 1:112703579-112703601 TAGGTCATTCAGTGACTGGGGGG + Intronic
915316729 1:155033027-155033049 TAGAACATGCAGGATGAGGGGGG + Intronic
918148656 1:181780034-181780056 CAGACCATCCAGGAGCTGGGAGG - Intronic
920517883 1:206599956-206599978 TTCATCAACCAGGAACTGGGAGG + Intronic
922429080 1:225529220-225529242 CAGATCATGCAGGACCTTGCAGG - Intronic
923998930 1:239529038-239529060 TGGATTATGAAGGAAATGGGAGG - Intronic
924800490 1:247326563-247326585 TGGGTTATGCAGGAAGTGGGGGG - Intronic
1062975108 10:1677378-1677400 TAGAACATGCTGGTACTGGGTGG + Intronic
1063885250 10:10570834-10570856 AAGAGCATGCAGGAAATGGTGGG + Intergenic
1066242246 10:33549593-33549615 GAGATTATGCAGGAAGTGGTGGG - Intergenic
1070019255 10:72567752-72567774 TATAGCATGCAGGAACTAGTGGG - Intronic
1071863466 10:89700274-89700296 TTGATTGTGCAGGACCTGGGAGG + Intergenic
1075995326 10:126872224-126872246 AAGCTCATGCAGGCCCTGGGGGG + Intergenic
1077922618 11:6653106-6653128 TAGACCATGCAGGGTCTAGGAGG - Intronic
1078288067 11:9978178-9978200 TAGGTTATGCAGGAAATTGGGGG - Intronic
1082984798 11:59159211-59159233 TCGATAACGCAGGAAGTGGGAGG - Intergenic
1088280055 11:108126432-108126454 CAGATCATGCAGGTTCTTGGAGG + Intronic
1088982402 11:114875550-114875572 GAGAGGATGAAGGAACTGGGTGG - Intergenic
1088994176 11:114982081-114982103 TAGAACATGGAGGCACTGAGGGG + Intergenic
1090401806 11:126453887-126453909 TATACCAAGCAGGAGCTGGGAGG - Intronic
1091006837 11:131961237-131961259 TTGATTATGCAGGAAATGGCAGG + Intronic
1091143363 11:133255173-133255195 CAGCACATGCAGGCACTGGGAGG - Intronic
1091239936 11:134045662-134045684 TAGATTATGTAGGACTTGGGGGG - Intergenic
1094055506 12:26265432-26265454 TAGATCATGAAGGACCTTGCAGG + Intronic
1094151635 12:27291008-27291030 TAGATTATGCTGGTACAGGGAGG - Intronic
1095634079 12:44410803-44410825 TAGAGCATCCAGGAACTGTGGGG + Intergenic
1097973400 12:65659406-65659428 TGGATCATGCAGGACCTCGCAGG - Intergenic
1098252521 12:68584961-68584983 CAGGTAATGCAGGAACTGGCAGG + Intergenic
1098499547 12:71174965-71174987 AAGAGCATGGAGGGACTGGGAGG + Intronic
1098986884 12:77022072-77022094 TAGAGCATTCAGGAACAGTGAGG + Exonic
1099511384 12:83543194-83543216 TATATCATGCATGAACTGAGAGG - Intergenic
1101625848 12:106440448-106440470 CAGATTGTGCAGGAACTGGAAGG - Intronic
1104106089 12:125660852-125660874 TAGATGCTGCAGGAACTGAGAGG + Exonic
1106310082 13:28546444-28546466 TAGATCATGCAGAACCTTGTAGG + Intergenic
1106446374 13:29835923-29835945 TAGATCATGCAGGACCCTGAAGG + Intronic
1107821029 13:44285843-44285865 CAGTTCATGCAGGACCTGAGGGG - Intergenic
1111242291 13:85490808-85490830 TAGATGATTCTGGAACTGGGAGG - Intergenic
1111571659 13:90095701-90095723 TAAATCATCCAGGAACTCAGAGG - Intergenic
1113578904 13:111414287-111414309 TAGATGAGGCAGGGACTTGGGGG + Intergenic
1114620000 14:24089993-24090015 CAGATCATGCAGAGCCTGGGAGG + Intronic
1115706620 14:36005849-36005871 TGAATCATGCAGGGACTCGGAGG + Intergenic
1118235950 14:64005120-64005142 TAGCTCATGCAGGAACTTTTAGG + Intronic
1119875902 14:78059109-78059131 GAAATCATCCAGGACCTGGGTGG + Intergenic
1120000427 14:79296890-79296912 CAGATCACGCAGGAACTGCTAGG - Intronic
1122716767 14:103700783-103700805 TTGCACATGCAGGGACTGGGGGG + Intronic
1123198358 14:106638775-106638797 TGGGTCATGCAGGAACTTGTAGG + Intergenic
1126690927 15:51288477-51288499 TAGATAAAGCAGGAACGCGGTGG - Intronic
1126807353 15:52364431-52364453 TTGAACATTCTGGAACTGGGTGG + Intronic
1127897765 15:63317586-63317608 TAGATCATGTTGGAATTGGAGGG - Intergenic
1129272337 15:74425757-74425779 GAGCACATGGAGGAACTGGGAGG - Intronic
1129958566 15:79662204-79662226 TTGATATGGCAGGAACTGGGAGG - Intergenic
1131273774 15:90963377-90963399 TACATCATGGATGAACTTGGAGG - Intergenic
1138044357 16:53705312-53705334 CAGATCATGCAGGATCTTGTAGG - Intronic
1138586965 16:57976752-57976774 TAGATCATGGAGGAGCAGGGAGG - Intronic
1142476869 17:193949-193971 AAGGTCATACAGCAACTGGGAGG + Intergenic
1142619166 17:1154159-1154181 AGGATCATGAAGGACCTGGGAGG - Intronic
1143615074 17:8044868-8044890 GAGACCATTCAGGAACTGGGAGG - Exonic
1146791803 17:35755074-35755096 TAGATCATGCAGGGCCTTGTAGG + Intronic
1148999565 17:51743114-51743136 TAGATCTTGCATGAAGTGGCTGG + Intronic
1149451861 17:56755934-56755956 CAAATCATGCAGGAGCTTGGGGG - Intergenic
1150640183 17:66944414-66944436 TAGATCATTCAGGCAGTGTGGGG - Intergenic
1152380808 17:79941507-79941529 CAGATCCTGCAGGAGCTGAGAGG - Intronic
1153200602 18:2643684-2643706 AAGATCATGCAGGGCCTTGGAGG - Intergenic
1155371824 18:25110209-25110231 TGGGTCTTGCAGGATCTGGGAGG + Intronic
1157441596 18:47715921-47715943 GAGATCAGGCAGGAACTGCAGGG + Intergenic
1162656773 19:12137368-12137390 GAGCACATGCAGGAACTGGGAGG - Intronic
1162828761 19:13270910-13270932 TAGATCATGCAGGAACTGGGAGG - Intronic
1163277536 19:16294799-16294821 CAGAACATGAAGGAACTGAGTGG + Intergenic
1165068683 19:33242930-33242952 AACATCATGGAGGAACTGGAAGG + Intergenic
1166588715 19:43975378-43975400 TAGATCATCCAGGACATGGATGG + Intronic
929084389 2:38154014-38154036 TAGATCAAGCAGGTTCTGGAGGG + Intergenic
930753099 2:54950891-54950913 GAGACCATGCTGGAATTGGGGGG - Intronic
931847739 2:66222184-66222206 AAGAAGGTGCAGGAACTGGGGGG - Intergenic
932989272 2:76766201-76766223 TAAATGAGGCTGGAACTGGGAGG + Intronic
933613810 2:84463302-84463324 CAGATCATGCCAGACCTGGGAGG + Intergenic
935862719 2:107350354-107350376 TAGCACATGCAAGAACTGTGTGG + Intergenic
938310430 2:130285542-130285564 AAGACCCTGCAGGAAGTGGGAGG + Intergenic
938650735 2:133380833-133380855 AGGATCATGCAGGAACTCAGGGG - Intronic
939420842 2:141966500-141966522 TAGATGCTGCAGGAGCTGGCTGG - Intronic
940736042 2:157453633-157453655 TAGAACATGCAGGACCTTGAAGG - Intronic
941681450 2:168403762-168403784 GAGATCAGGCAGAAACTGGAGGG + Intergenic
942428134 2:175880757-175880779 TAGATCATGCAGGACCTTCACGG + Intergenic
942791399 2:179765528-179765550 TAGTTCATGCAGGAACTGTGAGG + Intronic
944325777 2:198401825-198401847 CAGATCATGCAGGACCTTGTAGG - Intronic
946460688 2:219865894-219865916 TAGATCTTGCAGGACCTTGAAGG - Intergenic
946638622 2:221758299-221758321 TAGAACATAAAGGAAGTGGGAGG - Intergenic
946817949 2:223598308-223598330 TAAATGCTGCAGGAAGTGGGAGG - Exonic
1169742114 20:8906318-8906340 AGGAAGATGCAGGAACTGGGAGG - Intronic
1170926506 20:20729522-20729544 TAGATCATGGAGGAAGTGACAGG - Intergenic
1171047919 20:21828109-21828131 TAGATAAAGCAGGAAAAGGGAGG - Intergenic
1173880812 20:46410994-46411016 TCGTTCTTCCAGGAACTGGGGGG + Intronic
1174003209 20:47389868-47389890 AAGATCATGGAGGAACTTGGAGG - Intergenic
1176958184 21:15129999-15130021 TAGATCATGCAGGATCTTGAAGG + Intergenic
1178440998 21:32598161-32598183 TAGATGATACTGGAACTGTGTGG + Intronic
1178942419 21:36917163-36917185 CAGATCATGTAGGAGCTGGCAGG - Intronic
1181902083 22:26164549-26164571 TAGATCATGGAGACACTGGTTGG + Intergenic
1182902291 22:33908524-33908546 TTGATGATGCATGAAATGGGGGG + Intronic
953700819 3:45194442-45194464 TAGAACATGCAGAAACTGTGAGG - Intergenic
954092969 3:48300238-48300260 AAGATCATGCAGAGCCTGGGAGG - Intronic
960357799 3:116675043-116675065 GAGATCATTCAGGAAGAGGGTGG - Intronic
962072713 3:132048360-132048382 TGGATCATGCAGGACCTTGCAGG - Intronic
964082766 3:152779871-152779893 GACATCATGCAGAAAATGGGAGG + Intergenic
970595650 4:17597646-17597668 TATAGCATACAGGAAATGGGAGG - Intronic
971946723 4:33287856-33287878 TAAATTATTCAGAAACTGGGGGG + Intergenic
974184202 4:58425303-58425325 AAGTTCATGTAGGAACTTGGAGG - Intergenic
974298540 4:60035332-60035354 TACAGCATGCAGGAACCAGGTGG - Intergenic
980600680 4:135020223-135020245 TAGATAATACATGAACTGGATGG + Intergenic
981544626 4:145881619-145881641 CAGAGCATAAAGGAACTGGGAGG - Intronic
982929844 4:161390930-161390952 AAGATCATGCAGGAATGGAGAGG - Intronic
984823268 4:183903187-183903209 CAGATCATGCCGGAACTTGCAGG - Intronic
987605011 5:20123223-20123245 TAGATGATGCAGAATCTGTGAGG - Intronic
991245134 5:64502584-64502606 TATTTCTTGCAGGAGCTGGGGGG - Intergenic
996843350 5:127872583-127872605 AAGATCAAGCAGGGACTGGATGG - Intergenic
998528785 5:142866341-142866363 AAGATCATGCAGGGAATGAGTGG - Intronic
999411270 5:151351936-151351958 TGGATCATGCAGGACCTTGTGGG - Intergenic
1000244538 5:159438410-159438432 TAGGTCAGATAGGAACTGGGAGG + Intergenic
1000923096 5:167161771-167161793 TCGATCTTGCAAGAGCTGGGTGG + Intergenic
1001245614 5:170104216-170104238 TAGGGCATGCAGGAAGTGGGAGG + Intergenic
1002550120 5:179982068-179982090 TAGATCATGGAGGGATGGGGTGG - Intronic
1003527741 6:6911934-6911956 TAGATGATGCAGGAAAAGGAGGG - Intergenic
1005758483 6:28946655-28946677 TAGATCATGCAGGGTCTCAGAGG + Intergenic
1008092137 6:47304659-47304681 TATGTCATGCAGGAATTTGGTGG + Intronic
1011367008 6:86593782-86593804 TACAACATTCAGGAATTGGGAGG + Intergenic
1015228636 6:130887519-130887541 CAGATCATGCAGGGCCTTGGAGG - Intronic
1015738693 6:136429611-136429633 TATATCTTGTGGGAACTGGGGGG + Intronic
1015940921 6:138451107-138451129 TAGATCATGTAGGGTCTTGGAGG - Intronic
1016241697 6:141938882-141938904 TAGATCATGCAGGCAAAGGCTGG - Intergenic
1018772718 6:166986184-166986206 TAGATAGTGAAGGAACTGGGTGG - Intergenic
1019268886 7:134844-134866 CATCTCATGGAGGAACTGGGAGG - Intergenic
1020524060 7:9235835-9235857 CAGATCATGCAGCAACTTGTTGG + Intergenic
1021026619 7:15675861-15675883 TAGATAATAGAAGAACTGGGAGG - Intronic
1021919153 7:25466245-25466267 CACAACATGCAGGAACTTGGTGG + Intergenic
1022656950 7:32328446-32328468 CAGATCATGCAGGGACTTGGAGG - Intergenic
1023768337 7:43532484-43532506 TAGATCATGCCGGACTTGGCAGG - Intronic
1026548042 7:71341439-71341461 TGAATTATGTAGGAACTGGGTGG - Intronic
1041631731 8:60096412-60096434 TATAACATGCAGGGACTTGGGGG - Intergenic
1042846551 8:73174586-73174608 GAGATCATCCGGGAACTGGCCGG - Intergenic
1043542113 8:81275821-81275843 AATTTCATGCGGGAACTGGGAGG - Intergenic
1044426564 8:92058095-92058117 TAGATCATGCAGGAGCCCAGAGG - Intronic
1044489387 8:92793995-92794017 TAGATCATGGAGGATGTGGTTGG + Intergenic
1044672798 8:94700296-94700318 TAGATCATGAATTATCTGGGTGG + Intronic
1044824564 8:96183864-96183886 TAGGTCCTGCAGGCACTCGGAGG - Intergenic
1046814417 8:118568383-118568405 CAGATCATGCAGGATCTGGTAGG + Intronic
1047916233 8:129586901-129586923 TAGATCATGCAGAAATCAGGTGG + Intergenic
1047988450 8:130261135-130261157 GAGAGCATGCAGGAGCTGAGGGG - Intronic
1048849511 8:138630981-138631003 CAGATCTTGCATGAACTGAGTGG - Intronic
1049036268 8:140078694-140078716 GAGCCCATGCAGGAACTGAGAGG + Intronic
1052679087 9:31665555-31665577 GAGATGATGCAGGAATTGGGTGG - Intergenic
1055439543 9:76324615-76324637 TTGAACATGCAGGGACTGAGTGG - Intronic
1056930605 9:90873496-90873518 TATATCATGAAACAACTGGGGGG - Intronic
1057030270 9:91769763-91769785 CAGATCATGAAGGTACTGGAGGG - Intronic
1057281940 9:93719621-93719643 AAGGACATGCAGGAACTAGGCGG - Intergenic
1057832553 9:98418232-98418254 TAGATGATGCATGAGGTGGGAGG + Intronic
1057946831 9:99337812-99337834 TGGATCATGCTGGCACTGGATGG + Intergenic
1060304275 9:122396856-122396878 TAGCTCATGGAGCCACTGGGAGG + Intergenic
1060748616 9:126154294-126154316 TAGACCATGCAGCACCTGAGAGG - Intergenic
1061843601 9:133375163-133375185 GAGAGCATTCGGGAACTGGGTGG - Intronic
1187049315 X:15680162-15680184 TAGATCAGGCAGGATTTGGGGGG + Intergenic
1188228213 X:27628225-27628247 TAGATCATGTAGGAAATGAAAGG - Intronic
1188831424 X:34902599-34902621 TAGATTCTGCAGGGACGGGGAGG + Intergenic
1189148103 X:38675774-38675796 TCGTTCATGCAGCAGCTGGGGGG - Exonic
1189238173 X:39504989-39505011 TACATCATGGAGGAAAAGGGAGG + Intergenic
1190653175 X:52587178-52587200 TAGCTCATGAAGGGACTGGAGGG - Intergenic
1195238552 X:102927214-102927236 TAGATCATTCAGGGACCAGGAGG - Intergenic
1198556595 X:137799812-137799834 GAGATAATCCAGGAACTGTGAGG - Intergenic
1199862856 X:151817550-151817572 TAGATCATGCAGGAAGAGTGTGG - Intergenic
1200006871 X:153091792-153091814 TAGAGCATGCAGCACCTGTGTGG - Intergenic