ID: 1162833878

View in Genome Browser
Species Human (GRCh38)
Location 19:13303546-13303568
Sequence CTTGGTGAGCTCCTGGGCGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 6, 3: 21, 4: 283}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162833868_1162833878 6 Left 1162833868 19:13303517-13303539 CCAGAGAAACATTCTCCCACCGC 0: 1
1: 0
2: 0
3: 3
4: 110
Right 1162833878 19:13303546-13303568 CTTGGTGAGCTCCTGGGCGTTGG 0: 1
1: 0
2: 6
3: 21
4: 283
1162833867_1162833878 28 Left 1162833867 19:13303495-13303517 CCATGGGCAGGTGGTAACTTTGC 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1162833878 19:13303546-13303568 CTTGGTGAGCTCCTGGGCGTTGG 0: 1
1: 0
2: 6
3: 21
4: 283
1162833870_1162833878 -9 Left 1162833870 19:13303532-13303554 CCCACCGCCTCCACCTTGGTGAG 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1162833878 19:13303546-13303568 CTTGGTGAGCTCCTGGGCGTTGG 0: 1
1: 0
2: 6
3: 21
4: 283
1162833871_1162833878 -10 Left 1162833871 19:13303533-13303555 CCACCGCCTCCACCTTGGTGAGC 0: 1
1: 0
2: 2
3: 54
4: 260
Right 1162833878 19:13303546-13303568 CTTGGTGAGCTCCTGGGCGTTGG 0: 1
1: 0
2: 6
3: 21
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162833878 Original CRISPR CTTGGTGAGCTCCTGGGCGT TGG Exonic
900965635 1:5956380-5956402 CTTGATGACTTCCTGTGCGTGGG - Intronic
901497350 1:9629646-9629668 CTTGGGGAGCTGCTGGGAGAAGG + Intergenic
901795626 1:11677709-11677731 CCTGGAGAGCTGCTGGGCCTCGG - Intronic
901818451 1:11809326-11809348 CTTGGTGAGCTCCTAGAAGTAGG - Intronic
903241800 1:21987611-21987633 TGTGGTGACCTCCTGGGAGTGGG + Intronic
903245308 1:22010780-22010802 TGTGGTGACCTCCTGGGAGTGGG + Intronic
903963257 1:27070560-27070582 TTTGGTAAGCTCCTGGGCCCTGG + Intergenic
904101419 1:28032027-28032049 TGTGGTGACCTCCTGGGGGTGGG - Intronic
904660360 1:32079543-32079565 TATGGTGAACTCCTGGGAGTGGG - Intronic
905091770 1:35435980-35436002 GGAGGTTAGCTCCTGGGCGTGGG - Intronic
907312134 1:53544786-53544808 CTTTGTGAGGTTCTGGGCTTTGG + Intronic
908044840 1:60157417-60157439 CCTGGTGAAATCCTGGGCTTTGG + Intergenic
909907901 1:81221564-81221586 CTTGGGGAGCTCCTGGGTTTGGG - Intergenic
909943166 1:81634040-81634062 CTTGGAGTGCTCCAGGGCTTGGG - Intronic
910259954 1:85284898-85284920 CTTGGGGAGCTCCTAGGTCTGGG - Intergenic
911288628 1:96028422-96028444 CTTGGTGAGCTCCTAGGTCTGGG + Intergenic
912486800 1:110035153-110035175 CTTGGTGCACTCCAGGGCGCTGG + Intronic
914338418 1:146737972-146737994 CTGGGAGAGCTCCAGGGTGTAGG + Intergenic
914990373 1:152494749-152494771 CTTTCTGAGGTCCTGGGCTTGGG - Intergenic
915584549 1:156837284-156837306 CTTGGTGAGCCCCTGGACCCTGG - Intronic
916053072 1:161049431-161049453 CTGGAGGAGCTCCTGGGAGTTGG - Exonic
916281923 1:163061228-163061250 CTTGGGTAGCTCCTGTGCTTGGG + Intergenic
916418839 1:164617463-164617485 CTTGGTGTGCTCCTTGGAGCTGG + Intronic
916967020 1:169958092-169958114 TATGGTGACCTCCTGGGAGTTGG - Intronic
917167836 1:172133252-172133274 CTTGGTGAGCTCTTGGTTATTGG + Intronic
918141581 1:181724515-181724537 CTTGGTCAGTTCCTGGGCGTTGG - Exonic
918418317 1:184335781-184335803 TATGGTGACCTCCTGGGAGTGGG + Intergenic
918508139 1:185280552-185280574 CTTGGTGGGCTCCTGGATGGGGG + Intronic
919780385 1:201217212-201217234 CATGGGGAGCCCCTGGGGGTAGG - Intronic
920351970 1:205343611-205343633 CTTGGGGAGCGCCCGGGCGCCGG + Exonic
920381577 1:205537449-205537471 GATGCTGAGCTCCTGGGAGTGGG - Intergenic
920967057 1:210709809-210709831 ATGGGAGAGCTCCTGGGCTTGGG - Intronic
921467709 1:215509854-215509876 TTTGGTGAGCTCCTGGATGCGGG - Intergenic
921912930 1:220571884-220571906 TATGGTGACCTCCTGGGAGTGGG - Intronic
922775519 1:228212768-228212790 CGCGGTGAGCTCCTGGGTGCGGG + Exonic
923002695 1:230020680-230020702 CTTGGTGTGCTGGTGAGCGTAGG + Intergenic
923086676 1:230707901-230707923 CTTGCTGTGCTCCTGAGCATGGG - Intronic
1063970870 10:11380463-11380485 CTTGGTGGGCTCCTGGGTGGGGG + Intergenic
1067564402 10:47326336-47326358 CTTGGGAAGATCCTGGGCTTTGG - Intergenic
1067877435 10:50018625-50018647 GTTGGTGAGCTCCTGAGAGAGGG + Intergenic
1068343067 10:55734216-55734238 CTTGGTGAGCTCCTGGCTGGGGG - Intergenic
1070842858 10:79499891-79499913 CTGGGAGTGATCCTGGGCGTGGG + Intergenic
1075700352 10:124465257-124465279 CTTGGCGAGTTCGAGGGCGTGGG + Intronic
1075919712 10:126200504-126200526 CTTGGTGAGATCTTGGGCAAGGG + Intronic
1075932515 10:126311521-126311543 CTTGGTGGGCTCCTGGATGGGGG + Intronic
1076096967 10:127739732-127739754 CTTGGGGAACTCCTGGGTGCTGG - Exonic
1076872009 10:133198946-133198968 CGTGGTGGGCCCCAGGGCGTCGG - Exonic
1077155608 11:1089603-1089625 TTTGGTACACTCCTGGGCGTAGG - Intergenic
1077367805 11:2168205-2168227 CTTGGTGAGCTCGGAGCCGTGGG + Intronic
1077404788 11:2378047-2378069 CTTGATGAGCTCATGGGGGCGGG - Intronic
1079413923 11:20215246-20215268 CTTGGTAATCTCTTGGGCTTTGG + Intergenic
1081911103 11:46700532-46700554 CGCGGTGAGCTGCTGGGCGCGGG - Exonic
1083397364 11:62401026-62401048 CCTGGTGAGCCCCTCGGCCTGGG + Intergenic
1084083011 11:66841427-66841449 CTTTGTGAGCGCCTGGATGTGGG - Intronic
1086330573 11:85749852-85749874 CCTGGTGAGTTCCTGGGGGCAGG + Intronic
1087338847 11:96877707-96877729 CTTGGGGAGCTCCTAGGTCTGGG + Intergenic
1088635317 11:111814414-111814436 CTGGGGGAGCTCCTGGGTGCTGG + Intronic
1088651222 11:111959270-111959292 CTTGGGGAGCTCCTAGGTCTGGG - Intronic
1088883564 11:113989983-113990005 CATGGTGAGCTGCTGGGGGTGGG - Exonic
1092232497 12:6784008-6784030 CGTGGTGACCTCCCGGGAGTGGG - Intergenic
1095376064 12:41530617-41530639 CTGGGGGAACTCCTGGGCATAGG + Intronic
1095603294 12:44038256-44038278 CTTGGTGAGCTCCTAGGTATAGG - Intronic
1097500325 12:60393056-60393078 CTTGGGGAGCTCCTAGGTCTGGG - Intergenic
1099683259 12:85855712-85855734 CTTGGGGAGCTCCTAGGTCTGGG + Intergenic
1101873088 12:108581568-108581590 CTTGGGCAGGTCCTGGGCCTCGG - Intergenic
1102799340 12:115717848-115717870 TATGGTGACCTCCTGGGAGTGGG + Intergenic
1103907612 12:124335541-124335563 CTTGGGGAGCCCCTTGTCGTGGG + Exonic
1104805620 12:131587547-131587569 CTTGGGGAGCTCCTAGGTCTGGG - Intergenic
1105694999 13:22879267-22879289 CATGGTGACCTCCTGGGAGCAGG - Intergenic
1105861519 13:24419334-24419356 CTTGATGAGCTCCTGAGTGAGGG + Intergenic
1105937934 13:25119102-25119124 CTGAGCGAGCTCGTGGGCGTCGG - Intergenic
1107081873 13:36383660-36383682 CTTGGTGAACTGCTTGGCGAGGG + Intergenic
1107410019 13:40150068-40150090 CTCCGTGAGCTGCTGGGAGTGGG - Intergenic
1107648157 13:42516496-42516518 CTTGCTGGGCTCCAGGGGGTGGG - Intergenic
1108554863 13:51583039-51583061 GTTGGTTATCTCCTGGGTGTAGG + Intergenic
1110135511 13:72062635-72062657 CTTGCTGGGCTCCTTGGGGTGGG - Intergenic
1110439053 13:75507504-75507526 CTTGGTGAGCCCCTAGGTCTGGG + Intergenic
1110470696 13:75856434-75856456 CTTGGGGCACTCCTGGGGGTGGG - Intronic
1111581702 13:90231110-90231132 CTTGGTGAGGTCCTGCGATTTGG - Intergenic
1111897222 13:94156729-94156751 CTCTGGGAGCTCCTGGGCATGGG - Intronic
1112582542 13:100688817-100688839 CTTGCTGAGTTTCTGGGCATAGG + Intergenic
1114032604 14:18589373-18589395 CTTGGTGATCACCTGGGAGCTGG - Intergenic
1114077388 14:19168398-19168420 CTTGGTGATCACCTGGGAGCTGG - Intergenic
1114281129 14:21193139-21193161 CTTGGGGAGCTCCTAGGTCTGGG - Intergenic
1117766149 14:59085460-59085482 CTTGGTGGGCTCCTGGATGGGGG - Intergenic
1118345356 14:64936562-64936584 CATAGTGAGCTCCTGGGCTCAGG + Intronic
1120590114 14:86364685-86364707 CTTGGGGAGCTCCTAGGTCTGGG - Intergenic
1121877752 14:97469445-97469467 CTTGGTGAGCTCCTAGGTGCAGG + Intergenic
1122251976 14:100446169-100446191 CTTTGTGAGCTCCTGCCCCTGGG + Intronic
1122354499 14:101114828-101114850 GATGATGAGCTCCTGGGCATGGG - Intergenic
1202896373 14_GL000194v1_random:12976-12998 CTTGGTGATCACCTGGGAGCTGG + Intergenic
1124023056 15:25941289-25941311 CATGCTGAGGTCCTGGGGGTCGG + Intergenic
1124820953 15:33045034-33045056 CTTGGGGAGCTCCTAGGTCTGGG - Intronic
1125534703 15:40436437-40436459 CTTGGAGGGCTCCTGAGCGCCGG + Intergenic
1125747157 15:42004906-42004928 CTTGGTGGGCCCCGGGGCCTGGG + Intronic
1126191309 15:45881786-45881808 CTTGGTATGCTGCTGGGCCTTGG - Intergenic
1126480291 15:49111142-49111164 GTTGTTGAGCTCCTGGGCAGTGG - Intronic
1127984823 15:64061172-64061194 CTCGGTGGGCTCCTGTGCGGCGG + Intronic
1129183632 15:73892423-73892445 CTTGGGGAGCTCCTAGGTCTGGG - Intergenic
1130044695 15:80434880-80434902 CTTTCTGAGGTCCTGGGCGCAGG + Intronic
1131258830 15:90878052-90878074 CTGGGTGTGCTCCTTGGGGTGGG + Intronic
1132012670 15:98289968-98289990 CTTGCTGAGCTGCTGGCTGTGGG - Intergenic
1132697415 16:1208114-1208136 AATGGTGAGCTCTTGGGGGTAGG - Exonic
1132766942 16:1539178-1539200 CTTGGTGAGGCCCAAGGCGTGGG - Intronic
1132848639 16:2013312-2013334 CTTGGTGACCTCCTGGGAGCAGG + Intronic
1133830093 16:9315004-9315026 AGTGGTGAGCTCTTGGGAGTAGG - Intergenic
1134608092 16:15586899-15586921 CTTGGAGAGCTCTTGGGCCCCGG - Exonic
1135056998 16:19240082-19240104 CTTGGGGAGCTCCTGGGCCTGGG + Intronic
1138454554 16:57113865-57113887 CTTGGTAAGCTCCTGGAGGCCGG + Intronic
1139066178 16:63317816-63317838 CTTGGTGAGCTCCTTGGCATTGG + Intergenic
1139995860 16:70979382-70979404 CTGGGAGAGCTCCAGGGTGTAGG - Intronic
1141609093 16:85171083-85171105 CTTGTTGGGGCCCTGGGCGTTGG - Intergenic
1142321473 16:89385906-89385928 TGTGGTGACCTCCTGGGAGTGGG - Intronic
1143156871 17:4843036-4843058 CTTGGTAGGCTCCTGGCCTTGGG + Intronic
1144454661 17:15408926-15408948 CTTGGTGAGGTGCTGGGTGCCGG + Intergenic
1146425383 17:32732840-32732862 CTTGGGGAGCTCCTAGGTCTGGG - Intronic
1147560925 17:41508568-41508590 CTTGGTGAGCTCCCGGAGGGAGG + Intergenic
1148200354 17:45746235-45746257 CCTGCTGAGCTCCTGGGCTGAGG + Intergenic
1149599688 17:57885460-57885482 GTTGTTGAGCTCCTGGGGGGCGG + Exonic
1149936363 17:60810884-60810906 CTTGGTGAGATCCTGAGATTTGG - Intronic
1150176588 17:63063422-63063444 CTTGGTGGGCTCCTGGATGGGGG - Intronic
1150273131 17:63879681-63879703 CTTGTTGAATTCCTGGGCCTGGG - Intronic
1150319731 17:64202495-64202517 CTTGGTCAGATCCTGGGTGGGGG - Intronic
1150521125 17:65867037-65867059 CTTGGGGAGCTCCTGAGTCTGGG - Intronic
1152469534 17:80483074-80483096 CTTGGTGATGGCTTGGGCGTGGG + Intergenic
1152786894 17:82252997-82253019 ATTGGTGAGCCCCTGGGCATGGG - Exonic
1152956736 18:47025-47047 CTTGGTGATGCCCTGGGCCTTGG - Intergenic
1153427903 18:4987065-4987087 CTTGGGGAGCTCCTAGGTCTGGG + Intergenic
1154129532 18:11724810-11724832 CTTGGCCTGCTCCTGGGCCTTGG - Intronic
1155266254 18:24097212-24097234 CTTGTTGATTTTCTGGGCGTGGG - Intronic
1157042825 18:44060591-44060613 CTTGGGGAGCTCCTAGGCCTGGG + Intergenic
1157422858 18:47560603-47560625 CTTGCAGGACTCCTGGGCGTAGG + Intergenic
1157498035 18:48170498-48170520 TTTGGTGAGCTCCTCTGGGTGGG - Intronic
1157870929 18:51229567-51229589 CTTGGTCTGCTACTGGGCCTTGG - Intergenic
1158788099 18:60740359-60740381 CTTGGGGAGCTCCTAGGTCTAGG - Intergenic
1160841300 19:1148035-1148057 CTTGGCCAGCTCCTGCGCTTGGG + Intronic
1161163157 19:2771816-2771838 CTTGGGGAGGCCCTGGCCGTGGG + Intronic
1161216186 19:3096003-3096025 CTAGGTTAGCTCCTGGGCCGGGG + Intronic
1161453160 19:4357743-4357765 TTTGGTGAGGTCCTGGGCGTGGG + Intronic
1162408280 19:10489173-10489195 CTTGGTGAGGCCCTGGGGGCGGG - Exonic
1162439862 19:10686312-10686334 CCTGGTGAGCGCTTGGGCGTTGG + Intronic
1162833878 19:13303546-13303568 CTTGGTGAGCTCCTGGGCGTTGG + Exonic
1163024485 19:14502483-14502505 CATGTTGAGCTCCTGGGGATGGG + Intergenic
1165171090 19:33892049-33892071 CTTGTGGAGCTCCTGGGCTTGGG - Intergenic
1167016259 19:46842899-46842921 CCCGGTGAGCTCCTTGGCCTCGG + Intronic
1167404137 19:49293193-49293215 CTTTGTGAGAACCTGGGCTTAGG + Intronic
1167550633 19:50158249-50158271 TTTGGTAAGCTTCTGGGGGTGGG - Exonic
1202632788 1_KI270706v1_random:15719-15741 CTTGGGGAGCTCCTAGGTCTGGG + Intergenic
1202653091 1_KI270707v1_random:24330-24352 CTTGGGGAGCTCCTAGGTCTGGG - Intergenic
925128447 2:1477727-1477749 ATGGGTGAGCTCCAGGTCGTGGG + Intronic
925997291 2:9303884-9303906 CATGGTGAGGCCTTGGGCGTGGG + Intronic
926518927 2:13884604-13884626 CTTGCTGAGCTCCCTGGAGTTGG - Intergenic
926554631 2:14342303-14342325 CTTGGGGAGCTCCTTGGTCTGGG - Intergenic
927315446 2:21676030-21676052 CTGGGTGGGCTCCTGGGTGGAGG + Intergenic
928209246 2:29311647-29311669 CCAGGGGAGCTCCTGGGAGTGGG - Intronic
929838006 2:45426063-45426085 CTTGCTGAGCTCCATGGGGTTGG - Intronic
929954606 2:46446693-46446715 CTTGGTGGGCTCCTGGATGGGGG + Intronic
930971112 2:57397104-57397126 CTTGGGGAGCTCCTAGGTCTGGG + Intergenic
931479146 2:62622196-62622218 CTTGCTGGGCCCCTGGGGGTAGG + Intergenic
933042665 2:77488131-77488153 CTTGGGGAGCTCCTAGGTCTGGG - Intronic
933181766 2:79235448-79235470 CCTGGTCTGCTCCTGGGCCTTGG + Intronic
934978545 2:98822650-98822672 CTTGGGGCGCTCCGGGGCGGCGG + Exonic
935592844 2:104856802-104856824 GTTGGTGATCTCCTGCGCGGAGG - Exonic
937933057 2:127220197-127220219 CGGGGTGGGCTCCTGGGCGGCGG - Intergenic
937985323 2:127635711-127635733 CTTGGGCAGCTCCTGGGTGATGG - Exonic
938491835 2:131765202-131765224 CTTGGTGATCACCTGGGAGCTGG - Intronic
938495731 2:131797140-131797162 CTTGGTGATCACCTGGGAGCTGG + Intronic
943426630 2:187745787-187745809 CTTGGGGAGCTCCTAGGTCTGGG + Intergenic
943552500 2:189357642-189357664 CTTGCTGGGCTCATGGGGGTGGG + Intergenic
943840258 2:192571763-192571785 CTTGGTGATCTCATGGTAGTCGG - Intergenic
946157750 2:217818179-217818201 CTTGGTGAGCCCCAGGGTGCCGG + Exonic
947669925 2:231929606-231929628 CCTGCTGAGCTCTTGGGGGTGGG + Intergenic
947833699 2:233160008-233160030 CTTTCTGAGCACCTGGGCATAGG + Intronic
948177873 2:235958400-235958422 CTGGGGGAGGTGCTGGGCGTAGG - Intronic
1172220246 20:33269096-33269118 CAGGGTGAGTTCCTGGGTGTGGG - Intergenic
1173972189 20:47161569-47161591 CTCTGTGAGCTCCTCGGCCTTGG + Intronic
1174034278 20:47658064-47658086 CTTTGTGAGCTTCTGGGGGAGGG + Exonic
1176599062 21:8775321-8775343 CTTGGGGAGCTCCTAGGTCTGGG + Intergenic
1176616060 21:9028972-9028994 CTTGGTGATCACCTGGGAGCTGG + Intergenic
1176645001 21:9341599-9341621 CTTGGGGAGCTCCTAGGTCTGGG + Intergenic
1177530430 21:22351925-22351947 CTGGGTCAGTTCCTGGGCGGGGG + Intergenic
1178975251 21:37215736-37215758 TATGGTGACCTCCTGGGAGTGGG + Intergenic
1180293196 22:10862028-10862050 CTTGGTGATCACCTGGGAGCTGG - Intergenic
1180367950 22:11957635-11957657 CTTGGGGAGCTCCTAGGTCTGGG - Intergenic
1180378139 22:12113701-12113723 CTTGGGGAGCTCCTAGGTCTGGG + Intergenic
1180419369 22:12799580-12799602 CTTGGGGAGCTCCTAGGTCTGGG - Intergenic
1180456717 22:15516430-15516452 CTTGGTGATCACCTGGGAGCTGG - Intergenic
1182768697 22:32777582-32777604 CTTCCTGAGCTCCTGTGTGTCGG + Intronic
1184411545 22:44329070-44329092 AGTGGGGAGCTCCTGGGGGTGGG - Intergenic
1184762087 22:46550499-46550521 CTGGGTGGGCTCCTGGAGGTGGG + Intergenic
1185038498 22:48491508-48491530 CCTGCTGAGCTGCTGGGGGTTGG - Intronic
1185065811 22:48631193-48631215 CTTGGTGTGCTCCGGGGTCTTGG + Intronic
1185257772 22:49845599-49845621 CTTGGTGGGCTCCTGGATGGGGG - Intergenic
949566845 3:5253070-5253092 CCCGGTGACCTCCTGGGAGTGGG - Intergenic
950403312 3:12787933-12787955 CTTGGTGAGGTCCTGAGATTTGG + Intergenic
954070921 3:48142360-48142382 TTTGGTGAGCGCCTGAGCGGAGG - Intergenic
954634106 3:52062360-52062382 CTTGGTGACCTCATGGGAGATGG - Intergenic
954829059 3:53402768-53402790 CTTGGTGATTTTCTGGGAGTAGG - Intergenic
955409564 3:58647009-58647031 CTTGGTGAGCACCTTTGAGTAGG + Intronic
955489549 3:59468717-59468739 CTTTGTTAACTCCTGGGCCTAGG - Intergenic
956989909 3:74751336-74751358 CTTGGGGAGCTCCCAGGCCTGGG + Intergenic
958264895 3:91426688-91426710 CTTGGTGGGCTCCTGGATGGGGG + Intergenic
960667242 3:120122040-120122062 TATGGTGACCTCCTGGGAGTGGG + Intergenic
961525887 3:127497109-127497131 CTTGGGGAGCTCCTAGGTCTGGG - Intergenic
961815553 3:129548348-129548370 CTGGTAGAACTCCTGGGCGTGGG + Intronic
962182342 3:133221257-133221279 CTTGGTGGGCTCCTGGGTGGGGG - Intronic
962665488 3:137649942-137649964 CTTTGTGAGCTACTGGGAGAAGG - Intergenic
962884319 3:139609814-139609836 TATGGTGACCTCCTGGGAGTGGG - Intronic
963250277 3:143096321-143096343 CTTGGGGAGCTCCTAGGTCTGGG - Intergenic
964483353 3:157163211-157163233 CTTGGTGAGGTCCTGAGATTTGG + Intergenic
965924214 3:173958104-173958126 CTTGGGGAGCTCCTAGGTCTGGG + Intronic
966757419 3:183384537-183384559 CTTAGTCAGTTCCTGGGCGGGGG - Intronic
967083865 3:186076432-186076454 TATGGTGACCTCCTGGGAGTGGG - Intronic
967352663 3:188531436-188531458 CTTGGTGGGCTCCTGGATTTTGG + Intronic
967993182 3:195146872-195146894 CTTGGTGACCTCCTGGGAACGGG - Intronic
1202741890 3_GL000221v1_random:63469-63491 CTTGGGGAGCTCCTAGGTCTGGG - Intergenic
968917220 4:3501840-3501862 CTTGGTGGGCTCCTGGGGGAGGG - Intergenic
969461394 4:7331070-7331092 CTTGGTGTGCTCCAGGGCCAGGG + Intronic
970605775 4:17680867-17680889 CTAGGAGATTTCCTGGGCGTGGG - Intronic
973362417 4:49177693-49177715 CTTGGGGAGCTCCTAGGTCTGGG + Intergenic
974260206 4:59517407-59517429 CTTGGGGAGCTCCTAGGTCTGGG + Intergenic
975794929 4:77997048-77997070 GTTGGTGGGCTCCTGGGTGGAGG - Intergenic
977816168 4:101416363-101416385 CTTGGGGAGCTCCTAGGTCTGGG + Intronic
978229823 4:106385278-106385300 CTTGGGGAGCTCCCAGGCCTGGG + Intergenic
978498541 4:109385103-109385125 CTTGGGGAGCTCCTAGGTCTGGG - Intergenic
979099511 4:116598309-116598331 CTCGTTGAGCTCCTGGGCAAAGG - Intergenic
981615665 4:146640564-146640586 CTTGGTGAGCTTCTCGCGGTGGG - Exonic
981889125 4:149715489-149715511 CTTGGGGAGCTCCTAGGTCTGGG + Intergenic
982248680 4:153381869-153381891 TATGGTGACCTCCTGGGAGTGGG - Intronic
982545287 4:156725200-156725222 CTTGGGGAGCTCCTAGGTCTGGG - Intergenic
984067211 4:175062819-175062841 CTTGGTCTGCTCCTTGGCCTTGG - Intergenic
984375414 4:178922832-178922854 CTTGGGGAGCTCCTAGGTATAGG - Intergenic
984706079 4:182848178-182848200 CTCCCTGAGCTCCTGGGCGTGGG - Intergenic
1202759756 4_GL000008v2_random:99166-99188 CTTGGGGAGCTCCTAGGTCTGGG + Intergenic
985493503 5:192347-192369 CTTGCTGAGCTCCCGGGCGATGG - Exonic
988304600 5:29478778-29478800 CCTGTTGAGCTCCTGGGTGGTGG + Intergenic
992149983 5:73893319-73893341 CGTGGTGTTCTCCTGGGTGTTGG + Intronic
992693041 5:79258782-79258804 CTTGGGGAGCTCCTAGGTCTGGG + Intronic
998646617 5:144069165-144069187 CTTGGTGGGCTCCTGGAGGGGGG + Intergenic
999748804 5:154611025-154611047 CTTGCTGGGCGCGTGGGCGTGGG - Intergenic
1004043869 6:12008913-12008935 CTTGGGAAGAGCCTGGGCGTGGG + Intronic
1004884974 6:20042551-20042573 CTTGGTTTGGTCCTGGGCCTTGG + Intergenic
1006255918 6:32832265-32832287 CTTTGTGGACTCCTGGGCCTTGG - Intronic
1007694583 6:43724178-43724200 CTTGGTGTCCTCCGGGGCCTAGG + Intergenic
1007812740 6:44497863-44497885 CTTGGTGACTTCTTGGGGGTTGG - Intergenic
1011357480 6:86487572-86487594 CTTGGTGTGCTACTGGGCCATGG + Intergenic
1015300932 6:131652243-131652265 CTTGGGGAGCTCCTGCTCTTGGG + Intronic
1015378915 6:132544508-132544530 CTTGGTGAGCTACTGAGCCCAGG - Intergenic
1017156311 6:151325560-151325582 CTTGCTGAGCTCCAGGACTTCGG - Intronic
1018470162 6:164088152-164088174 CTTGGTGAGTTCCCGGCAGTTGG + Intergenic
1019525792 7:1479877-1479899 CTGGGGCAGCTCCTGGGTGTTGG - Intronic
1019646212 7:2130365-2130387 CCTGGGGAACTCCTGGGAGTTGG - Intronic
1019748124 7:2712109-2712131 AATGGTGAGCTCTTGGGGGTGGG + Intronic
1020391423 7:7662236-7662258 CTTGCTGAGCTCCATGGGGTTGG + Intronic
1021097332 7:16548427-16548449 CTTGGGGAGCTCCTAGGTCTGGG - Intronic
1022064073 7:26832786-26832808 CTTGGTATCCTCCTGGGCTTAGG - Intronic
1022959475 7:35412846-35412868 CTTGAGGAGCACCTGTGCGTAGG + Intergenic
1023096816 7:36669809-36669831 CTCAGAGAGCTCCTGGGCTTAGG + Intronic
1023410927 7:39888498-39888520 TATGGTGACCTCCTGGGAGTGGG + Intergenic
1024706802 7:51970202-51970224 CTTGTTGGGCTCCTGGGTGGAGG + Intergenic
1024828728 7:53422528-53422550 CTTGCTGAGCTGCTGGTGGTGGG + Intergenic
1026933789 7:74240028-74240050 CCTGGTGAGGATCTGGGCGTCGG + Exonic
1027575265 7:79922916-79922938 CTTGGGGAGCTCCTAGGTCTAGG - Intergenic
1028596115 7:92547476-92547498 CTTGGGGAGCTCCTAGGTCTGGG - Intergenic
1029227327 7:99037592-99037614 CTTGGAGAGATCCGGGGAGTGGG - Intronic
1032747740 7:134805060-134805082 CTTAGTCAGCTCCTGGGTGGGGG + Intronic
1036755257 8:11467099-11467121 GTGGGTGAGGCCCTGGGCGTGGG - Intronic
1037445149 8:18957770-18957792 CTTGGTGATCTCATGAGCTTTGG - Intronic
1039921596 8:41897211-41897233 CTTGGGGAGCCCCCGGGCGGTGG + Intergenic
1040497003 8:47974596-47974618 CTTGATGAGCTCCGGGGCCCAGG + Intronic
1040951256 8:52940623-52940645 CTTGGCGCGCTCCAGGGCCTTGG - Exonic
1043166956 8:76915218-76915240 CTTGGTGCGCTCTTGGGAGGAGG + Intergenic
1044767068 8:95587567-95587589 CTAGGTGAACTCATGGGCCTTGG - Intergenic
1046503674 8:115110998-115111020 CTTGGGGAGCTCCTAGGTCTGGG + Intergenic
1047282669 8:123459537-123459559 CTTGGTGAGCTCCTGGACAGGGG - Intronic
1047347120 8:124039199-124039221 CCTGGAGAGCTCCTGGGAGAAGG - Intronic
1048614692 8:136059986-136060008 CCTGGTCTGCTCCTGGGCATTGG - Intergenic
1049325651 8:142020193-142020215 CTTGGTGAGCTCCTGGGAGCAGG + Intergenic
1049572195 8:143374575-143374597 CTGGGTGGGCTCCCAGGCGTGGG - Intronic
1050630051 9:7549361-7549383 CCTGCTGAGCTCCTGGGGGGAGG + Intergenic
1051548597 9:18304370-18304392 CCTTGTGAGCTCCTGGGTGTCGG + Intergenic
1053272105 9:36757242-36757264 AGTGGAGAGCTCCTGGGGGTGGG + Intergenic
1054794622 9:69288776-69288798 CTTGGTGAGCTCTTGGATGGCGG - Intergenic
1054892819 9:70270527-70270549 CTTGTTGGGCTCCTGGATGTGGG - Intronic
1056089493 9:83190873-83190895 CTTGGTAATTTCCTGGGCATGGG - Intergenic
1056322043 9:85444427-85444449 CACGGTGAGCTGCAGGGCGTTGG - Intergenic
1056591561 9:87969338-87969360 CTCAGTGAGCTCCTGGGCCAGGG + Exonic
1056780455 9:89545401-89545423 CATGGTGATCTCCTGTGCTTTGG + Intergenic
1057577326 9:96253686-96253708 CTTGGTGAGCTGCTTTGCTTTGG + Intronic
1059067780 9:111103483-111103505 CATGCTGAGCTCCTGGGGGTTGG - Intergenic
1059340837 9:113596781-113596803 CTTGGTGTGCTCCCGCGTGTAGG - Exonic
1060110641 9:120904240-120904262 CTGGGTGTGCTCCTGCGTGTTGG + Exonic
1060175509 9:121494654-121494676 TATGGTGATCTCCTGGGAGTGGG + Intergenic
1060675758 9:125513046-125513068 TATGGTGAGCTCCCGGGAGTGGG - Intronic
1060920881 9:127419515-127419537 CTTGGTGACTTCCTCTGCGTTGG + Intergenic
1062460310 9:136660128-136660150 CTTGCTGAGCCCCTGGGCCTTGG + Intronic
1062715924 9:138010055-138010077 CTTGGTCAGCTCTTGGGCGTTGG - Exonic
1203691547 Un_GL000214v1:47381-47403 CTTGGGGAGCTCCTAGGTCTGGG + Intergenic
1203710520 Un_KI270742v1:93393-93415 CTTGGGGAGCTCCTAGGTCTGGG - Intergenic
1203540532 Un_KI270743v1:84061-84083 CTTGGGGAGCTCCTAGGTCTGGG + Intergenic
1203644748 Un_KI270751v1:56810-56832 CTTGGGGAGCTCCTAGGTCTGGG - Intergenic
1185569660 X:1123859-1123881 CTGGGTGGCCTCCTGGGCGGAGG - Intergenic
1185734951 X:2489382-2489404 CATGCTGAGCTCCTTGGAGTCGG + Exonic
1186499598 X:10040743-10040765 CTTGGTGGGCTCCTGGATGGGGG - Intronic
1188195006 X:27222624-27222646 CTTGGGGAGCCCCTGGGGCTAGG - Intergenic
1188207853 X:27381400-27381422 CTTGGGGAGCTCCTAGGTCTGGG - Intergenic
1189726222 X:43970195-43970217 GTGGGTGAGCTCCAGGGCCTGGG - Intronic
1189953655 X:46257307-46257329 CTAAGTGAGTTCCTGGGTGTGGG + Intergenic
1190297997 X:49039820-49039842 CTCTCTGAGCTCCTGGGGGTGGG + Intronic
1192930292 X:75799509-75799531 CTTGCTGAGTTCCTGGGGGGAGG - Intergenic
1201149447 Y:11087696-11087718 CTTGGTGATCACCTGGGAGCTGG + Intergenic