ID: 1162835996

View in Genome Browser
Species Human (GRCh38)
Location 19:13318413-13318435
Sequence TGGCCTGGTGGACCACAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 214}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162835996 Original CRISPR TGGCCTGGTGGACCACAAGG AGG Intronic
900269406 1:1779182-1779204 TGGCCTGGGGCACCTCTAGGGGG + Intronic
900598553 1:3493442-3493464 TGGACTGGGGGACATCAAGGGGG - Intronic
900738600 1:4316542-4316564 TGGCCTGGAGGAGCAGAAGGTGG + Intergenic
901671415 1:10858322-10858344 TGGCCTGGTGGAGACCAAGAGGG + Intergenic
902771132 1:18646296-18646318 TGGCCTGGTGGCCCATACAGGGG + Intronic
903236017 1:21951284-21951306 TCACCTGGTGAACCCCAAGGTGG - Intergenic
905096476 1:35475892-35475914 TGGCTTTGTGGAACACAAGAGGG - Intronic
907425345 1:54375888-54375910 TGCCCAGGGGGGCCACAAGGTGG + Intronic
908300264 1:62755765-62755787 TGTCCTCCTAGACCACAAGGAGG - Intergenic
910112249 1:83695007-83695029 TGGGCTGATGGGCCACAATGGGG + Intergenic
911063780 1:93769875-93769897 TCTCCTGGTGGCCCACAAGTGGG - Intronic
911298812 1:96149333-96149355 TGTCCTCCTAGACCACAAGGAGG - Intergenic
913469345 1:119173728-119173750 TGTCCTCCTAGACCACAAGGAGG - Intergenic
916939359 1:169663434-169663456 TGTCCTCCTAGACCACAAGGAGG - Intronic
917445968 1:175106092-175106114 TGTCCTCCTAGACCACAAGGAGG + Intronic
917790035 1:178493566-178493588 GGGCCCGGTGGAGCACAAGGAGG + Intergenic
917801276 1:178572794-178572816 TACCCTGGTGGGCCACCAGGAGG + Intergenic
918750314 1:188262226-188262248 TGTCCTCCTAGACCACAAGGAGG + Intergenic
921469071 1:215526907-215526929 TGGCCTGTTGGTTCTCAAGGAGG + Intergenic
923697412 1:236267084-236267106 TGACCTGTTGGACCAAAAGAAGG - Intronic
1062768122 10:80666-80688 TGGCCTGGTGGGGCACATGGGGG + Intergenic
1063304356 10:4883285-4883307 TGGGCTGGTGGATCACAAGCTGG - Intergenic
1063321868 10:5058813-5058835 TGTCCTCCTAGACCACAAGGAGG + Intronic
1063998149 10:11640580-11640602 TAACCTGGAGGAACACAAGGAGG + Intergenic
1064603713 10:17017341-17017363 TGTCCTCCTAGACCACAAGGAGG + Intronic
1066614719 10:37283127-37283149 TGTCCTCCTAGACCACAAGGAGG + Intronic
1067203375 10:44193985-44194007 TGCTCTGGGGGGCCACAAGGAGG + Intergenic
1069137484 10:64783389-64783411 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1069728900 10:70598691-70598713 TGGCCTGGTGGACTACACCCTGG - Exonic
1070264924 10:74892965-74892987 GGGCCTGGTGGTCTACATGGAGG + Intronic
1072371798 10:94771950-94771972 TGTCCTCGTAGACCACAAAGAGG + Intronic
1072978409 10:100079118-100079140 TGGCATGGAGGAAGACAAGGAGG - Intronic
1075360246 10:121825749-121825771 TGGCCTTATGGAACACAGGGTGG + Intronic
1076690922 10:132223563-132223585 TGCCCAGGTGGCTCACAAGGTGG - Intronic
1077324411 11:1957529-1957551 TGGCCTGTGGGAGCAAAAGGGGG + Intronic
1077493745 11:2874866-2874888 TTGCCTGGTGGCCCACATGCAGG - Intergenic
1079731382 11:23940165-23940187 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1081543349 11:44051921-44051943 AGACATGGTGGACCTCAAGGAGG + Intronic
1083369552 11:62167328-62167350 TGGCCTGGAGGCCCAAAGGGCGG - Intergenic
1083736600 11:64685200-64685222 TGGCCTGGTGGAGCAGATGAGGG - Intronic
1084181828 11:67450776-67450798 GGCCCTGGTGAACCACAAGCTGG - Intergenic
1084210836 11:67621445-67621467 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1091318830 11:134635427-134635449 TTGCCTGATGAACCAGAAGGAGG - Intergenic
1202807392 11_KI270721v1_random:12706-12728 TGGCCTGTGGGAGCAAAAGGGGG + Intergenic
1092472150 12:8789689-8789711 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1093580701 12:20781876-20781898 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1094099325 12:26744189-26744211 GGGCCTTGTGGGCCACAGGGAGG - Intronic
1096256070 12:50063155-50063177 TGGCCTGGCTGGCCTCAAGGTGG - Intronic
1096747224 12:53736985-53737007 TGTGCTGGTGGACTACAAGAAGG - Intergenic
1101759562 12:107647614-107647636 TGGCCTGGGTGAGAACAAGGCGG + Intronic
1102579815 12:113879172-113879194 TGCCCTGGTGGACCCCACAGAGG - Intronic
1105762330 13:23526254-23526276 TGTCCTCCTGGACCACAAGGGGG - Intergenic
1106162546 13:27214106-27214128 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1106486719 13:30179204-30179226 TGGCCTGTTGGACCAAAACCTGG + Intergenic
1106783892 13:33087868-33087890 TGGGCTGGGGTACCACAAAGGGG + Intergenic
1108026104 13:46179716-46179738 TGGTCTGGTGCACCAAAATGTGG + Intronic
1109500900 13:63235289-63235311 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1109814962 13:67569414-67569436 GGACCATGTGGACCACAAGGAGG + Intergenic
1112047111 13:95609037-95609059 TGGCCAGGCTGACCACAAGTGGG + Intronic
1112518979 13:100079768-100079790 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1113887983 13:113670922-113670944 GAGCCAGGCGGACCACAAGGCGG - Intronic
1115285605 14:31710526-31710548 TGTCCTCCTAGACCACAAGGAGG + Intronic
1118010996 14:61610548-61610570 TGGCCTGGTGGGCCACATTTAGG - Intronic
1121226823 14:92327324-92327346 TGTCCTGGTGGCCCAGCAGGCGG + Intronic
1122138887 14:99650382-99650404 TGGCCTGGTGGACTCACAGGTGG + Intronic
1122279220 14:100611238-100611260 TGGGCGGGTGCACCTCAAGGAGG + Intergenic
1122296733 14:100709974-100709996 GGGCCGGGTAGACCACCAGGTGG + Intergenic
1122338617 14:101009770-101009792 TGGCTTGGTACACCACAAGTGGG - Intergenic
1122772149 14:104102308-104102330 TGGCATGGTGGAGCTGAAGGGGG - Intronic
1122819781 14:104335577-104335599 GGGCCTGGTGGACCATGTGGAGG + Intergenic
1122883837 14:104701835-104701857 AGGCCTGGGGAACCACCAGGAGG + Intronic
1124899304 15:33807678-33807700 AGGCCTGGGGGACCTCCAGGCGG - Intronic
1125613346 15:40987926-40987948 TGGCCTGCTGGTCCACAGTGGGG + Exonic
1127489062 15:59444970-59444992 TTTCCTGGTGGACCAGAAAGAGG - Intronic
1132726258 16:1339558-1339580 TGACCAGGTGGACGACGAGGAGG + Exonic
1132948749 16:2548074-2548096 GGGCCTGGAGGACCTCTAGGCGG + Intronic
1132965838 16:2654053-2654075 GGGCCTGGAGGACCTCTAGGCGG - Intergenic
1134700025 16:16257485-16257507 TGGTCTGTAGGACCACTAGGTGG + Intronic
1134971799 16:18537174-18537196 TGGTCTGTAGGACCACTAGGTGG - Intronic
1135435031 16:22420950-22420972 GGACCGGGTGGTCCACAAGGTGG + Intronic
1135602061 16:23792018-23792040 AGCCCTGGGGGACCACAAGTGGG - Intergenic
1135982023 16:27155188-27155210 TACCCTGGTCGGCCACAAGGGGG + Intergenic
1136047228 16:27624256-27624278 TGCCCCGGTGGCCCACGAGGAGG + Intronic
1136275612 16:29177737-29177759 TGGCCTGGGAGGCCACAGGGAGG - Intergenic
1139506587 16:67401087-67401109 CGGTCAGGTGCACCACAAGGTGG + Exonic
1140030558 16:71334911-71334933 TGGCCTGGTGGAAGGCAAGCTGG - Intergenic
1142888560 17:2928568-2928590 TGACCTGGGGGACCACGAGAAGG - Intronic
1142962264 17:3558199-3558221 TAGCCTGGTTGACCTCAGGGTGG + Intergenic
1143247983 17:5501753-5501775 GGGCTTGGTGGATGACAAGGAGG - Intronic
1144960868 17:19043203-19043225 TGGCCTGGTGGACAAAGCGGGGG - Intronic
1144974292 17:19131321-19131343 TGGCCTGGTGGACAAAGCGGGGG + Intronic
1145814815 17:27787965-27787987 AAGCCAGGTGGACCCCAAGGAGG - Intronic
1146184749 17:30717499-30717521 GGGCCTTGTGGACCTCAAGGAGG - Intergenic
1146269638 17:31476580-31476602 TGGGCTGGTGGGGCACTAGGGGG + Intronic
1146310365 17:31763884-31763906 TGACCTCCTAGACCACAAGGAGG - Intergenic
1147565685 17:41535221-41535243 TAGCCTGATGGCCCACATGGTGG - Intergenic
1148178456 17:45586559-45586581 TGGCTGTGGGGACCACAAGGAGG - Intergenic
1149599673 17:57885414-57885436 TGGCCTGGTTGAACTCCAGGCGG + Exonic
1151567863 17:74909841-74909863 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1151802692 17:76387106-76387128 GGCCCTGCTGGACCACAACGGGG - Exonic
1153642143 18:7166315-7166337 GGGCGTGGAGGAGCACAAGGAGG - Intergenic
1154111017 18:11568414-11568436 TGACCTGGTGGCCCACGAAGAGG - Intergenic
1154285552 18:13053072-13053094 TGCCCTGGAGGACCGCAAGGTGG + Exonic
1156502491 18:37568299-37568321 TGTCCTAGGGGACCAGAAGGAGG - Intergenic
1157858057 18:51119093-51119115 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1159763405 18:72456308-72456330 TGGCCTGCAGGACCACACAGGGG - Intergenic
1161238833 19:3210764-3210786 GGGCCTGGTGGGCCACGGGGAGG + Intergenic
1161277456 19:3426629-3426651 GGGCCTTGTGGGCCACAGGGAGG - Intronic
1161621410 19:5299214-5299236 GGGCCTTGTGGGCCACCAGGAGG - Intronic
1161625421 19:5323708-5323730 AGGCCTGGTGGGCTACAGGGAGG + Intronic
1161716048 19:5876872-5876894 TGCCCTTGTGGAACCCAAGGAGG + Intronic
1162835996 19:13318413-13318435 TGGCCTGGTGGACCACAAGGAGG + Intronic
1162864880 19:13538211-13538233 GGGTCTTGTGGACCACAGGGGGG + Intronic
1162974034 19:14198197-14198219 GGGCCTTGTGGACCTCAGGGAGG + Intronic
1163754821 19:19100484-19100506 GACCCTGGGGGACCACAAGGAGG - Intronic
1166109353 19:40613091-40613113 TGGCCGTGGGGACCACAGGGAGG - Exonic
1166753882 19:45178967-45178989 TGGCATGGTGGACCAGGTGGAGG + Intronic
1167002785 19:46755864-46755886 TGGCCTGCTGGAGCGCATGGTGG + Exonic
925950058 2:8901381-8901403 TGTCCTCCTAGACCACAAGGAGG + Intronic
926998015 2:18759178-18759200 TGGTCAGGTGGAACCCAAGGTGG + Intergenic
929330227 2:40673571-40673593 TTTCCTCCTGGACCACAAGGAGG - Intergenic
930503478 2:52253807-52253829 TGCCCTGGAGGAACACAAGTAGG - Intergenic
932096434 2:68853688-68853710 TGTACTGGTGGACAACAAGATGG + Intergenic
937252871 2:120535173-120535195 TGTCCTGGTGGACCCCCAGTGGG - Intergenic
937524052 2:122745536-122745558 AGGCCTGGTGGAACAAATGGAGG - Intergenic
940494582 2:154409612-154409634 TTGCATGGTGGGCCACATGGAGG + Intronic
942261768 2:174172287-174172309 TTGCCTGGAGGACCCCTAGGAGG - Intronic
943133602 2:183886919-183886941 TGTCCTCCTAGACCACAAGGAGG - Intergenic
944728820 2:202498236-202498258 TGTCCTCCTAGACCACAAGGAGG - Intronic
945992040 2:216404188-216404210 TGTCCCTGAGGACCACAAGGGGG - Intergenic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
947533360 2:230926407-230926429 TGGGCTGGTGGCCCAGTAGGGGG - Intronic
948909570 2:240996349-240996371 TGGGCTGGTGGGCCTCACGGGGG - Intergenic
948979320 2:241485094-241485116 TGACAGGGAGGACCACAAGGAGG - Intronic
1168902681 20:1378223-1378245 AGGCCAGGCGTACCACAAGGTGG + Intronic
1169331934 20:4722996-4723018 GGGCCTGGGGGAACACCAGGAGG - Intronic
1172096095 20:32461196-32461218 GGGCCTGGTGGGCCCAAAGGAGG - Intronic
1172412979 20:34740393-34740415 TGGCCTAGTGGAGGAGAAGGTGG - Exonic
1174132765 20:48357726-48357748 TGGCCTGCTGAACCACCAAGAGG + Intergenic
1175287301 20:57845385-57845407 TGGCCTGGTTGACCATAGGCTGG + Intergenic
1176103195 20:63373821-63373843 TGGGCTGGGGGATCACAAAGAGG - Intronic
1177724906 21:24954949-24954971 TGGGAGGGTGGATCACAAGGCGG + Intergenic
1179156317 21:38854049-38854071 GAGCCTGGTAGACCACAAGTAGG - Intergenic
1180183247 21:46127251-46127273 CGACCTGGAGGACCACAGGGAGG + Intronic
1183315274 22:37133632-37133654 TGGCCTGGTGGAGGGCAAAGCGG - Intronic
1183958688 22:41397803-41397825 TGGCCTGGTGGATCACCAAGAGG + Exonic
1183992905 22:41610614-41610636 TGGCCCGGAAGACCACAAGTGGG + Intronic
1185095643 22:48804627-48804649 TGTCCTGGAGGACCACAGGCTGG + Intronic
1185213129 22:49583184-49583206 TGGCCTGGTGGGGCTCACGGTGG + Intronic
952452862 3:33448044-33448066 TGTCCTCCTGGACCACAAGGAGG - Intergenic
952883965 3:38001692-38001714 TGGCCTGGTGGCCCTGCAGGTGG - Exonic
952959388 3:38580090-38580112 TGGCCTCTGGGACCACAGGGAGG + Intronic
953134002 3:40167179-40167201 TTACCTGCGGGACCACAAGGAGG + Exonic
954163274 3:48737090-48737112 GTGACTGGTGGGCCACAAGGGGG + Intronic
954333744 3:49904235-49904257 TGGCCTGGGGGCCCACCATGTGG + Intronic
954807686 3:53229912-53229934 TGGGCTCCTGGACCACCAGGAGG + Intronic
958549373 3:95594084-95594106 TGTCCTCCTAGACCACAAGGAGG + Intergenic
961035356 3:123638028-123638050 TGGACTGGTGGACCACTTGGTGG - Intronic
962978178 3:140464258-140464280 TGGCTTGGTGGCCCACAATAGGG - Intronic
963008423 3:140748133-140748155 TGGTCTTGTGGCCCCCAAGGAGG - Intergenic
963060217 3:141219717-141219739 AGGACAGGTGGACCTCAAGGTGG + Intergenic
964064342 3:152561304-152561326 TGTCCTCCTAGACCACAAGGAGG - Intergenic
966905991 3:184526047-184526069 TGGCCAGGTGGAGCAAGAGGAGG + Intronic
967313410 3:188127887-188127909 AGGCATGGTGGACTACAAGCTGG + Intergenic
967848595 3:194064585-194064607 TGGCCTGAGGCACCTCAAGGAGG - Intergenic
968622588 4:1610549-1610571 GGGCCTGGAGGACAACAGGGAGG + Intergenic
969710532 4:8840650-8840672 GGGCCAGGTGGAAGACAAGGGGG - Intergenic
971314193 4:25553597-25553619 TTGCCTGCTGGACCACAGAGAGG + Intergenic
973045706 4:45532862-45532884 TGTCCTCCTAGACCACAAGGAGG - Intergenic
974839017 4:67280888-67280910 TGTCCTCCTAGACCACAAGGAGG + Intergenic
979666512 4:123316862-123316884 TGGCCAGGAAGACCACAAGGAGG + Exonic
984924032 4:184791078-184791100 TGGCCTGGCCGCCCACAGGGAGG + Intronic
985647861 5:1093562-1093584 GGGCGTGGTGGAGCACGAGGAGG - Exonic
985708594 5:1415482-1415504 TGGCCAGGCAGACCACAAGCAGG - Intronic
992897162 5:81255127-81255149 TGCCCTGGAGGGCCTCAAGGGGG + Exonic
995706199 5:114991405-114991427 TGTCCTCCTAGACCACAAGGAGG - Intergenic
999036138 5:148352247-148352269 TGGCCTGGTAGACAACTTGGTGG - Intergenic
1001414961 5:171539319-171539341 TGGACTTGTGGACGACAGGGGGG - Intergenic
1001999429 5:176189415-176189437 TGGCCTGGAGGAGCAGCAGGAGG + Intergenic
1002461339 5:179375456-179375478 TGGCCTGTTTAAGCACAAGGAGG - Intergenic
1002649745 5:180682490-180682512 TGGCCTGGAGGAGCAGCAGGAGG - Intergenic
1002939607 6:1704474-1704496 TGGTCTGTTGGAGCAAAAGGAGG + Intronic
1003296105 6:4830306-4830328 TCATCTGGTGGACCACTAGGAGG + Intronic
1003413315 6:5885447-5885469 GGGCCTAGTGGACCACACTGAGG - Intergenic
1006841667 6:37032305-37032327 GGGCCTGGTGGAGCACACGGAGG - Intergenic
1008587179 6:52960631-52960653 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1009872614 6:69469636-69469658 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1013536388 6:111066716-111066738 GGGCCTGGTGGAACACAGTGTGG - Intergenic
1016183846 6:141177580-141177602 TGGCCTCCTAGACCACAAAGAGG - Intergenic
1018913012 6:168115040-168115062 TGGTCTCCTGGATCACAAGGTGG - Intergenic
1019146514 6:169978707-169978729 TGGCCTGTTGGCCCAGAAAGTGG + Intergenic
1019477970 7:1253060-1253082 GGGCCTGGGGGTCCCCAAGGTGG + Intergenic
1021093042 7:16505230-16505252 AGGCCTGGTGGTCTTCAAGGGGG + Intronic
1021900782 7:25283093-25283115 TGGCATGATGGACAACAAGGCGG - Intergenic
1022430763 7:30317885-30317907 TGGCCTGGTGTAGCAGATGGAGG + Intronic
1023861933 7:44221722-44221744 TGGCCTGTTGGAATCCAAGGGGG - Intronic
1026932123 7:74229063-74229085 TGGCCAGGTGGTCCTCAGGGTGG - Exonic
1028858804 7:95623360-95623382 TGGCCTTGTGAACCCCAAGTTGG - Intergenic
1029279154 7:99425514-99425536 TGGCCTAGGGGACCCCCAGGTGG - Exonic
1029641777 7:101825433-101825455 GAGCCTGGAGGACCACAAGGTGG + Intronic
1029713675 7:102314136-102314158 TGGCCTGGTCAATCACACGGTGG + Intronic
1030656495 7:112173932-112173954 TGGGCAGGTGACCCACAAGGAGG + Intronic
1033759425 7:144423423-144423445 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1037390581 8:18387530-18387552 GGGGCTGGTCGTCCACAAGGTGG - Intergenic
1038638615 8:29306476-29306498 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1040965242 8:53075679-53075701 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1042101109 8:65275771-65275793 TGGCCTGGTGGTACAAGAGGTGG + Intergenic
1045249739 8:100473482-100473504 TGGCCTGGTGGGCTTCATGGAGG + Intergenic
1045499404 8:102733482-102733504 GTGCCTGGTGGTCCACAGGGAGG + Intergenic
1045839026 8:106558425-106558447 TGGCCTGGTAGGCCAAATGGAGG + Intronic
1049656787 8:143802584-143802606 TGGCCTGCAGGGCCACAAGAGGG - Intronic
1050287491 9:4118241-4118263 AGGCCTGGTCAACCACATGGTGG - Exonic
1051120426 9:13746399-13746421 TGGCCTGGTGAAGAACATGGGGG - Intergenic
1053203817 9:36170267-36170289 TGTCCTGATGGACCGCAAGCAGG + Exonic
1053207925 9:36203556-36203578 TGGTTTTGTGGAACACAAGGTGG - Intronic
1055859519 9:80731071-80731093 TGGGGTGGTGGGCCACTAGGTGG + Intergenic
1056796252 9:89660752-89660774 TGGCCAGAAGGACCTCAAGGAGG - Intergenic
1057289056 9:93788775-93788797 TGGCCTGGTAGAGCACCAGGTGG - Intergenic
1061265107 9:129500326-129500348 AGGGCTGGTGGAACACAAAGGGG + Intergenic
1061523417 9:131137011-131137033 TGGCCAGGTGGCCCATTAGGAGG + Intronic
1062310288 9:135931749-135931771 TGGCCTGAGCGTCCACAAGGTGG - Intergenic
1190541263 X:51481044-51481066 TGTCCTGCTAGACCACAAAGAGG - Intergenic
1192870225 X:75177416-75177438 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1196662145 X:118280503-118280525 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1199832593 X:151560714-151560736 TGTCCTCCTAGACCACAAGGAGG + Intergenic
1201429509 Y:13890367-13890389 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1201496581 Y:14595904-14595926 TGTCCTCCTAGACCACAAGGAGG + Intronic
1201744153 Y:17352435-17352457 TGTCCTGCTAGACCACAAAGAGG + Intergenic
1202395686 Y:24421320-24421342 TGTCCTCCTAGACCACAAGGAGG - Intergenic
1202475099 Y:25248772-25248794 TGTCCTCCTAGACCACAAGGAGG + Intergenic